HUGE

Gene/Protein Characteristic Table for KIAA0370

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK07379
Accession No. :	AB002368
Description :	Exportin-6.
HUGO Gene Name :	exportin 6 (XPO6)
Clone Name :	sj06874 [Vector Info]
Flexi ORF Clone :	pF1KA0370
Source :
Note :	We replaced hh00184 and hh00184s1, former representative clones for KIAA0370 with sj06874. (2002/5/10,2005/08/06)

Features of the cloned DNA sequence	Description

Length: 4422 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 543 bp

Genome contig ID gi51511732r_27916817
PolyA signal sequence
(AATAAA,-11)
+----*----+----*----+----*----+----
AAACTAAGAAGCTTAATGAAAAGAAATAAAATGCC
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
TATGTTGTTGTTCTAGAAACCCTGGCTGGGGAGCTGCTTGCTACTCACAG

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 16 r 28016817 28130691 24 100.0 Perfect prediction

Features of the protein sequence	Description

Length: 1132 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q96QU8	100.0	Exportin-6; Sho...	Homo sapiens
XP_001138416	99.9	exportin 6 isof...	Pan troglodytes
AAI44190	99.8	XPO6 protein [H...	Homo sapiens
EAW55736	100.0	exportin 6, iso...	Homo sapiens
XP_001137656	99.3	exportin 6 isof...	Pan troglodytes

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR001494 38 104 PF03810 Importin-beta

IPR013598 110 260 PF08389 Exportin-1/Importin-beta-like

ProfileScan IPR001494 38 104 PS50166 Importin-beta

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001494	38	104	PF03810	Importin-beta
IPR013598	110	260	PF08389	Exportin-1/Importin-beta-like
ProfileScan	IPR001494	38	104	PS50166	Importin-beta

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR Description

Experimental conditions

Primer_f
: CGTCACATCTCTCCTTGGCTG

Primer_r
: ACTAGGAGGCACCAGGAAATC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR	Description

RH mapping information	Description

Chromosome No.

: 16

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: CGTCACATCTCTCCTTGGCTG
Primer_r	: ACTAGGAGGCACCAGGAAATC
PCR product length	: 133 bp
PCR conditions	: 95 °C15 sec66 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	543 bp
Genome contig ID	gi51511732r_27916817
PolyA signal sequence (AATAAA,-11)	+--------+--------+----*----+---- AAACTAAGAAGCTTAATGAAAAGAAATAAAATGCC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* TATGTTGTTGTTCTAGAAACCCTGGCTGGGGAGCTGCTTGCTACTCACAG

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	16	r	28016817	28130691	24	100.0	Perfect prediction

Gene/Protein Characteristic Table for KIAA0370

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information