| HUGE |
Gene/Protein Characteristic Table for KIAA0365 |
|
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
| Features : DNA sequence | Protein sequence | Expression | Mapping | |
| Product ID : | ORK01074 |
|---|---|
| Accession No. : | AB002363 |
| Description : | Putative splicing factor, arginine/serine-rich 14. |
| HUGO Gene Name : | splicing factor, arginine/serine-rich 14 (SFRS14) |
| Clone Name : | hh00120s1 [Vector Info] |
| Flexi ORF Clone : | pF1KA0365
![]() |
| Source : | Human adult brain |
| Note : | We replaced hh00120, former representative clones for KIAA0365 with hh00120s1. (2005/08/06) |
Features of the cloned DNA sequence |
Description | |
|---|---|---|
Length: 5545 bp
|
| cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | NO |
Length of 3'UTR 1998 bp Genome contig ID gi42406306r_18864461 PolyA signal sequence
(None) +----*----+----*----+----*----+----
CTCCAGCCTGGGCGACAGAGCAAGACTCCATCTCCFlanking genome sequence
(99715 - 99666) ----+----*----+----*----+----*----+----*----+----*
AAAAAAAAAAAAAAAAAAGGCCGGCACGGTGACTCACGCCTATAATTCCA
Chr f/r start end exon identity class ContigView(URL based/DAS) 19 r 18964176 19005832 10 99.6 Perfect prediction
Features of the protein sequence |
Description | |
|---|---|---|
Length: 1181 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
No significant homologues
Expression profile |
Description | |
|---|---|---|
| RT-PCR | Description |
|---|
| : CAAGTGGCATTTCCCGCTCAG | |
| : TTCTCCACTCATCCTTCCTTG | |
| : 95 °C |
RH mapping information |
Description | |
|---|---|---|
| : 19 |
| : GeneBridge 4 | |
| : CAAGTGGCATTTCCCGCTCAG | |
| : TTCTCCACTCATCCTTCCTTG | |
| : 154 bp | |
| : 95 °C |
|
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage
| |