HUGE

Gene/Protein Characteristic Table for KIAA0350

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK01071
Accession No. :	AB002348
Description :
HUGO Gene Name :
Clone Name :	hg01945 [Vector Info]
Flexi ORF Clone :	pF1KA0350
Source :	Human adult brain
Note :	We replaced hg01581, former representative clones for KIAA0350 with hg01945. (2002/5/10)

Features of the cloned DNA sequence	Description

Length: 6786 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
YES

Integrity of 3' end

Length of 3'UTR 3491 bp

Genome contig ID gi51511732f_10845943
PolyA signal sequence
(AATAAA,-20)
+----*----+----*----+----*----+----
AAATTTAAACTTGGCAATAAAAGAGAAAAAAAGTT
Flanking genome sequence
(337598 - 337647)
----+----*----+----*----+----*----+----*----+----*
ACCAAGAATGTAGCGTGCTGCTCCTGGGGGCTGTGGCAGGAGGCCGTGGC

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 16 f 10945943 11183539 23 100.0 Perfect prediction

Features of the protein sequence	Description

Length: 1062 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
XP_001104364	0	97.3	similar to CG12...	Macaca mulatta
XP_871847	0	93.1	similar to Prot...	Bos taurus
BAE42005	0	94.5	unnamed protein...	Mus musculus
BAE33184	0	94.1	unnamed protein...	Mus musculus
CAG02693	1e-209	65.4	unnamed protein...	Tetraodon nigro...

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

ScanRegExp IPR001304 575 597 PS00615 C-type lectin

Search method	interpro_ID	From	To	Entry	Definition
ScanRegExp	IPR001304	575	597	PS00615	C-type lectin

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR Description
: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: TTCCAGTTTTCATTTCCACCC

Primer_r
: TTGTCCCAGTGAGAACCGAGG

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR	Description

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 16

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: TTCCAGTTTTCATTTCCACCC
Primer_r	: TTGTCCCAGTGAGAACCGAGG
PCR product length	: 137 bp
PCR conditions	: 95 °C15 sec64 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	YES

Length of 3'UTR	3491 bp
Genome contig ID	gi51511732f_10845943
PolyA signal sequence (AATAAA,-20)	+--------+--------+----*----+---- AAATTTAAACTTGGCAATAAAAGAGAAAAAAAGTT
Flanking genome sequence (337598 - 337647)	----+--------+--------+--------+--------+----* ACCAAGAATGTAGCGTGCTGCTCCTGGGGGCTGTGGCAGGAGGCCGTGGC

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	16	f	10945943	11183539	23	100.0	Perfect prediction

Gene/Protein Characteristic Table for KIAA0350

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information