| HUGE | 
| Gene/Protein Characteristic Table for KIAA0348 | 
| Link to : 
Rouge | 
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
| Features : DNA sequence | Protein sequence | Expression | Mapping | |
| Product ID : | |
|---|---|
| Accession No. : | AB002346 | 
| Description : | Synaptojanin-2. | 
| HUGO Gene Name : | |
| Clone Name : | hg01551 [Vector Info] | 
| Flexi ORF Clone : | pF1KA0348  | 
| Source : | Human adult brain | 
| Features of the cloned DNA sequence | Description | |
|---|---|---|
Length: 6562 bp
|   | 
The cloned DNA sequence was revised by direct RT-PCR/sequencing experiments following the alert of coding interruption by GeneMark analysis.
| cloned DNA seq. | Warning for N-terminal truncation: YES | YES | Warning for coding interruption: YES | NO |  | 
Length of 3'UTR 2172 bp Genome contig ID gi89161210f_158258255 PolyA signal sequence 
(None)
GGTAGTAGGTATGGTTCTCATACCAGAATTCTCTTFlanking genome sequence 
(181303 - 181352)
AAAAAAAAAAAAAAGGACAATTGGAATTGCCTTATTTATTTTTAAAATCA
Chr f/r start end exon identity class ContigView(URL based/DAS) 6 f 158358255 158439556 26 100.0 Perfect prediction 
| Features of the protein sequence | Description | |
|---|---|---|
Length: 1443 aa
This protein sequence is predicted from the revised DNA sequence
|  | 
 | 
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
|  | 
 | 
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
 
    | Expression profile | Description | |
|---|---|---|
| RT-PCR | Description | 
|---|
| : CCTACTACCAACTCCAAATCC | |
| : TAGGTTTTCTCTTCGTTCCAG | |
| : 95 °C | 
| RH mapping information | Description | |
|---|---|---|
| : 6 | 
| : GeneBridge 4 | |
| : CCTACTACCAACTCCAAATCC | |
| : TAGGTTTTCTCTTCGTTCCAG | |
| : 243 bp | |
| : 95 °C | 
| How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage   | |