| HUGE |
Gene/Protein Characteristic Table for KIAA0291 |
|
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
| Features : DNA sequence | Protein sequence | |
| Product ID : | ORK01970 |
|---|---|
| Accession No. : | AB006629 |
| Description : | CAP-Gly domain-containing linker protein 2. |
| HUGO Gene Name : | CAP-GLY domain containing linker protein 2 (CLIP2) |
| Clone Name : | fh25236 [Vector Info] |
| Flexi ORF Clone : | pF1KA0291
![]() |
| Source : | Human fetal brain |
| Note : | We replaced ha06799, former representative clones for KIAA0291 with fh25236. (2001/5/29) |
Features of the cloned DNA sequence |
Description | |
|---|---|---|
Length: 5445 bp
|
| cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | YES |
Length of 3'UTR 2082 bp Genome contig ID gi89161213f_73241741 PolyA signal sequence
(AATAAA,-20) +----*----+----*----+----*----+----
GTCTGTGCTCGGGACAATAAAGCTTGTGACAGGTCFlanking genome sequence
(216457 - 216506) ----+----*----+----*----+----*----+----*----+----*
CAGGACCCCGGCAGTTGGCTTGTCTCCTCCTCTCCGTGGGGACCCCGGGC
Chr f/r start end exon identity class ContigView(URL based/DAS) 7 f 73341741 73458196 16 99.5 Perfect prediction
Features of the protein sequence |
Description | |
|---|---|---|
Length: 1024 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
|
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage
| |