| HUGE |
Gene/Protein Characteristic Table for KIAA0290 |
|
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
| Features : DNA sequence | Protein sequence | Mapping | |
| Product ID : | ORK00498 |
|---|---|
| Accession No. : | AB006628 |
| Description : | FCH domain only protein 1. |
| HUGO Gene Name : | FCH domain only 1 (FCHO1) |
| Clone Name : | ha06644 [Vector Info] |
| Flexi ORF Clone : | pF1KSDA0290
![]() |
| Source : | Human adult brain |
Features of the cloned DNA sequence |
Description | |
|---|---|---|
Length: 2979 bp
|
| cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | NO |
Length of 3'UTR 256 bp Genome contig ID gi42406306f_17626926 PolyA signal sequence
(AATAAA,-19) +----*----+----*----+----*----+----
CTTTATTTTCTAATAAAATAAAAAAGGAAACCTTTFlanking genome sequence
(133447 - 133496) ----+----*----+----*----+----*----+----*----+----*
TCCTGCTCCAGGAAGTATCCTTTGCGTTGCCAGAGAGGGGAGGAAGAGAA
Chr f/r start end exon identity class ContigView(URL based/DAS) 19 f 17726919 17760371 26 99.6 Perfect prediction
Features of the protein sequence |
Description | |
|---|---|---|
Length: 906 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
No significant homologues
RH mapping information |
Description | |
|---|---|---|
| : 19 |
| : Genebridge 4 | |
| : TTCCAGATGTGTCCGAGGCAG | |
| : CCTGTGGCAAACCTCCTCTTC | |
| : 190 bp | |
| : 95 °C |
|
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage
| |