| HUGE |
Gene/Protein Characteristic Table for KIAA0282 |
|
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
| Features : DNA sequence | Protein sequence | Mapping | |
| Product ID : | ORK00493 |
|---|---|
| Accession No. : | D87458 |
| Description : | Tripartite motif-containing protein 9. |
| HUGO Gene Name : | |
| Clone Name : | ha06845s1 [Vector Info] |
| Flexi ORF Clone : | pF1KSDA0282
|
| Source : | Human adult brain |
| Note : | We replaced ha06845, former representative clones for KIAA0282 with ha06845s1. (2002/5/10) |
Features of the cloned DNA sequence |
Description | |
|---|---|---|
Length: 4298 bp
|
| cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | NO |
Length of 3'UTR 2162 bp Genome contig ID gi51511730r_50411736 PolyA signal sequence
(AATAAA,-21)
ATTTCTGATGTGCCAATAAATGATTTTTATGAGAGFlanking genome sequence
(100000 - 99951)
AATAAAATGTCTCTAGAATTTCTTAGTTTTTATCTATTGCGGATGACAAT
Chr f/r start end exon identity class ContigView(URL based/DAS) 14 r 50511736 50631548 10 99.4 Perfect prediction
Features of the protein sequence |
Description | |
|---|---|---|
Length: 711 aa
 |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
No significant homologues
RH mapping information |
Description | |
|---|---|---|
| : 14 |
| : Genebridge 4 | |
| : GGGTGCTATCCTGTTTATGTG | |
| : TATGAGTCTACCACGGCCCAG | |
| : 128 bp | |
| : 95 °C |
|
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage 
| |
