HUGE

Gene/Protein Characteristic Table for KIAA0273

Link to : GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00487
Accession No. :	D87463
Description :	Phytanoyl-CoA hydroxylase-interacting protein.
HUGO Gene Name :	phytanoyl-CoA 2-hydroxylase interacting protein (PHYHIP)
Clone Name :	ha06723 [Vector Info]
Flexi ORF Clone :	pF1KSDA0273
Source :	Human adult brain

Features of the cloned DNA sequence	Description

Length: 3040 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 1644 bp

Genome contig ID gi51511724r_22033167
PolyA signal sequence
(None)
+----*----+----*----+----*----+----
ATAAACCACCATGGCCTGAGGGCCCTGCTCGTCTC
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AGTCCATTTGAGCTGCTGTAACAAAATACCACACATTGGGTGGCTCAGAA

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 8 r 22133167 22145505 6 99.1 Perfect prediction

Features of the protein sequence	Description

Length: 356 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
XP_001106477	3.1e-164	100.0	phytanoyl-CoA h...	Macaca mulatta
XP_528082	3.3e-164	100.0	phytanoyl-CoA h...	Pan troglodytes
XP_543252	5.8e-154	97.9	similar to Phyt...	Canis lupus fam...
AAH30494	1.2e-152	98.2	Phyhip protein ...	Mus musculus
Q92561	2.6e-151	100.0	Phytanoyl-CoA h...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB058699	1.1e-76	75.1	KIAA1796

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR003961 30 131 PF00041 Fibronectin

ProfileScan IPR003961 29 134 PS50853 Fibronectin

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR003961	30	131	PF00041	Fibronectin
ProfileScan	IPR003961	29	134	PS50853	Fibronectin

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: Northern blot Description

Northern blot	Description

RH mapping information	Description

Chromosome No.

: 8

Experimental conditions

Panel name	: Genebridge 4
Primer_f	: GTGAGGGACAGGTGGACAACG
Primer_r	: CTGGGCCATGTTCTCTCCTTC
PCR product length	: 131 bp
PCR conditions	: 95 °C15 sec68 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	1644 bp
Genome contig ID	gi51511724r_22033167
PolyA signal sequence (None)	+--------+--------+----*----+---- ATAAACCACCATGGCCTGAGGGCCCTGCTCGTCTC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AGTCCATTTGAGCTGCTGTAACAAAATACCACACATTGGGTGGCTCAGAA

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	8	r	22133167	22145505	6	99.1	Perfect prediction

Gene/Protein Characteristic Table for KIAA0273

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information