HUGE

Gene/Protein Characteristic Table for KIAA0266

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00042
Accession No. :	D87455
Description :	U3 small nucleolar RNA-associated protein 14 homolog C.
HUGO Gene Name :	asparagine-linked glycosylation 11, alpha-1,2-mannosyltransferase homolog (yeast) (ALG11)
Clone Name :	ha02755 [Vector Info]
Flexi ORF Clone :	pF1KA0266
Source :	Myeloblast cell line (KG-1)

Features of the cloned DNA sequence	Description

Length: 5585 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
YES

Integrity of 3' end

Length of 3'UTR 2551 bp

Genome contig ID gi51511729f_51396828
PolyA signal sequence
(ATTAAA,-14)
+----*----+----*----+----*----+----
ATTCCCAAGCTCCATATGCCAATTAAAGAAGAAAC
Flanking genome sequence None

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 13 f 51496828 51515697 4 98.8 Terminal No-hit

Features of the protein sequence	Description

Length: 766 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q5TAP6	100.0	U3 small nucleo...	Homo sapiens
AAI22537	99.9	UTP14, U3 small...	Homo sapiens
AAH89407	99.9	UTP14C protein ...	Homo sapiens
XP_509792	99.0	UTP14, U3 small...	Pan troglodytes
XP_001106440	93.0	similar to UTP1...	Macaca mulatta

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR006709 29 735 PF04615 Small-subunit processome

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR006709	29	735	PF04615	Small-subunit processome

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: Northern blot Description

Northern blot	Description

RH mapping information	Description

Chromosome No.

: 13

Experimental conditions

Panel name	: Genebridge 4
Primer_f	: CAGCAGTGGAGATTTGTATTC
Primer_r	: GAGCTTGGGAATATTAGTAGG
PCR product length	: 255 bp
PCR conditions	: 95 °C15 sec60 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	YES

Length of 3'UTR	2551 bp
Genome contig ID	gi51511729f_51396828
PolyA signal sequence (ATTAAA,-14)	+--------+--------+----*----+---- ATTCCCAAGCTCCATATGCCAATTAAAGAAGAAAC
Flanking genome sequence	None

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	13	f	51496828	51515697	4	98.8	Terminal No-hit

Gene/Protein Characteristic Table for KIAA0266

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information