| HUGE |
Gene/Protein Characteristic Table for KIAA0238 |
|
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
| Features : DNA sequence | Protein sequence | Expression | Mapping | |
| Product ID : | ORK00473 |
|---|---|
| Accession No. : | D87075 |
| Description : | Solute carrier family 23 member 2. |
| HUGO Gene Name : | solute carrier family 23 (nucleobase transporters), member 2 (SLC23A2) |
| Clone Name : | fg04858 [Vector Info] |
| Flexi ORF Clone : | pF1KSDA0238
![]() |
| Source : | Human fetal brain |
| Note : | We replaced ha02544, former representative clones for KIAA0238 with fg04858. (2002/5/10) |
Features of the cloned DNA sequence |
Description | |
|---|---|---|
Length: 6941 bp
|
| cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | YES |
Length of 3'UTR 4613 bp Genome contig ID gi51511747r_4681005 PolyA signal sequence
(AATAAA,-21) +----*----+----*----+----*----+----
AACTGTTCCGTACAAATAAAAGCTCTCCTGGACACFlanking genome sequence
(100000 - 99951) ----+----*----+----*----+----*----+----*----+----*
AGTTTTGCTCTTCACGTGCCTCCTTCTTGGGCTACTCTTTAAGAAAAGAG
Chr f/r start end exon identity class ContigView(URL based/DAS) 20 r 4781005 4930145 17 100.0 Perfect prediction
Features of the protein sequence |
Description | |
|---|---|---|
Length: 676 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
No significant homologues
Expression profile |
Description | |
|---|---|---|
| Northern blot | Description |
|---|
| RT-PCR-ELISA | Description |
|---|

RH mapping information |
Description | |
|---|---|---|
| : 20 |
| : Genebridge 4 | |
| : ACGTTGCCATCTTACTGACAG | |
| : AACAACCCCACCCCAAATACC | |
| : 223 bp | |
| : 95 °C |
|
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage
| |