HUGE

Gene/Protein Characteristic Table for KIAA0235

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00471
Accession No. :	D87078
Description :	Pumilio homolog 2.
HUGO Gene Name :	pumilio homolog 2 (Drosophila) (PUM2)
Clone Name :	ha04677s1 [Vector Info]
Flexi ORF Clone :	pF1KSDA0235
Source :	Myeloblast cell line (KG-1)
Note :	We replaced ha04677, former representative clones for KIAA0235 with ha04677s1. (2002/5/10)

Features of the cloned DNA sequence	Description

Length: 6040 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
YES

Integrity of 3' end

Length of 3'UTR 2845 bp

Genome contig ID gi89161199r_20211982
PolyA signal sequence
(AATGAA,-33)
+----*----+----*----+----*----+----
AAAATGAAAAATGTGTGAATAACATTGTATGAAAT
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AAACCTGGTCTTGTGTTTTTCTCTAGATAAAATACCCCTCTGTACCTCAG

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 2 r 20311982 20390602 20 99.5 Perfect prediction

Features of the protein sequence	Description

Length: 1064 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q8TB72	99.8	Pumilio homolog...	Homo sapiens
XP_001140509	99.8	pumilio homolog...	Pan troglodytes
XP_001095741	99.4	similar to pumi...	Macaca mulatta
XP_001095854	99.4	similar to pumi...	Macaca mulatta
XP_849088	98.5	similar to pumi...	Canis lupus fam...

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
D43951	5.1e-93	76.6	KIAA0099

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR001313 726 760 PF00806 Pumilio/Puf RNA-binding

IPR001313 762 796 PF00806 Pumilio/Puf RNA-binding

IPR001313 798 832 PF00806 Pumilio/Puf RNA-binding

IPR001313 834 868 PF00806 Pumilio/Puf RNA-binding

IPR001313 870 904 PF00806 Pumilio/Puf RNA-binding

IPR001313 906 940 PF00806 Pumilio/Puf RNA-binding

IPR001313 942 976 PF00806 Pumilio/Puf RNA-binding

IPR001313 985 1019 PF00806 Pumilio/Puf RNA-binding

HMMSmart IPR001313 726 761 SM00025 Pumilio/Puf RNA-binding

IPR001313 762 797 SM00025 Pumilio/Puf RNA-binding

IPR001313 798 833 SM00025 Pumilio/Puf RNA-binding

IPR001313 834 869 SM00025 Pumilio/Puf RNA-binding

IPR001313 870 905 SM00025 Pumilio/Puf RNA-binding

IPR001313 906 941 SM00025 Pumilio/Puf RNA-binding

IPR001313 942 977 SM00025 Pumilio/Puf RNA-binding

IPR001313 985 1020 SM00025 Pumilio/Puf RNA-binding

ProfileScan IPR001313 706 1046 PS50303 Pumilio/Puf RNA-binding

IPR001313 726 761 PS50302 Pumilio/Puf RNA-binding

IPR001313 762 797 PS50302 Pumilio/Puf RNA-binding

IPR001313 798 833 PS50302 Pumilio/Puf RNA-binding

IPR001313 834 869 PS50302 Pumilio/Puf RNA-binding

IPR001313 870 905 PS50302 Pumilio/Puf RNA-binding

IPR001313 906 941 PS50302 Pumilio/Puf RNA-binding

IPR001313 942 977 PS50302 Pumilio/Puf RNA-binding

IPR001313 978 1020 PS50302 Pumilio/Puf RNA-binding

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001313	726	760	PF00806	Pumilio/Puf RNA-binding
IPR001313	762	796	PF00806	Pumilio/Puf RNA-binding
IPR001313	798	832	PF00806	Pumilio/Puf RNA-binding
IPR001313	834	868	PF00806	Pumilio/Puf RNA-binding
IPR001313	870	904	PF00806	Pumilio/Puf RNA-binding
IPR001313	906	940	PF00806	Pumilio/Puf RNA-binding
IPR001313	942	976	PF00806	Pumilio/Puf RNA-binding
IPR001313	985	1019	PF00806	Pumilio/Puf RNA-binding
HMMSmart	IPR001313	726	761	SM00025	Pumilio/Puf RNA-binding
IPR001313	762	797	SM00025	Pumilio/Puf RNA-binding
IPR001313	798	833	SM00025	Pumilio/Puf RNA-binding
IPR001313	834	869	SM00025	Pumilio/Puf RNA-binding
IPR001313	870	905	SM00025	Pumilio/Puf RNA-binding
IPR001313	906	941	SM00025	Pumilio/Puf RNA-binding
IPR001313	942	977	SM00025	Pumilio/Puf RNA-binding
IPR001313	985	1020	SM00025	Pumilio/Puf RNA-binding
ProfileScan	IPR001313	706	1046	PS50303	Pumilio/Puf RNA-binding
IPR001313	726	761	PS50302	Pumilio/Puf RNA-binding
IPR001313	762	797	PS50302	Pumilio/Puf RNA-binding
IPR001313	798	833	PS50302	Pumilio/Puf RNA-binding
IPR001313	834	869	PS50302	Pumilio/Puf RNA-binding
IPR001313	870	905	PS50302	Pumilio/Puf RNA-binding
IPR001313	906	941	PS50302	Pumilio/Puf RNA-binding
IPR001313	942	977	PS50302	Pumilio/Puf RNA-binding
IPR001313	978	1020	PS50302	Pumilio/Puf RNA-binding

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: Northern blot Description

Northern blot	Description

RH mapping information	Description

Chromosome No.

: 2

Experimental conditions

Panel name	: Genebridge 4
Primer_f	: TTCATCCTTGCCCTCTGTTGG
Primer_r	: TATTGGGAAGATTGGGTTGTC
PCR product length	: 152 bp
PCR conditions	: 95 °C15 sec66 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	YES

Length of 3'UTR	2845 bp
Genome contig ID	gi89161199r_20211982
PolyA signal sequence (AATGAA,-33)	+--------+--------+----*----+---- AAAATGAAAAATGTGTGAATAACATTGTATGAAAT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAACCTGGTCTTGTGTTTTTCTCTAGATAAAATACCCCTCTGTACCTCAG

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	2	r	20311982	20390602	20	99.5	Perfect prediction

Gene/Protein Characteristic Table for KIAA0235

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information