HUGE

Gene/Protein Characteristic Table for KIAA0226

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00036
Accession No. :	D86979
Description :
HUGO Gene Name :
Clone Name :	fg02838 [Vector Info]
Flexi ORF Clone :	pF1KA0226
Source :	Human fetal brain
Note :	We replaced ha04633, former representative clones for KIAA0226 with fg02838. (2001/10/06)

Features of the cloned DNA sequence	Description

Length: 5396 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 2377 bp

Genome contig ID gi89161205r_198783253
PolyA signal sequence
(AATAAA,-21)
+----*----+----*----+----*----+----
TAATAAACTAAGGAAATAAAATTCTGTCTTTCGTC
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AGCCTGCCTTGACTGTCAAGAAATGGCATGTGTCCACTGTAAAGCAGGTA

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 3 r 198883253 198960656 22 99.8 Perfect prediction

Features of the protein sequence	Description

Length: 973 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
XP_001926534	2e-189	91.5	similar to CG12...	Sus scrofa
BAC26925	1.3e-175	84.0	unnamed protein...	Mus musculus
BAC31257	1.4e-175	84.0	unnamed protein...	Mus musculus
XP_001373567	1.7e-175	81.1	similar to hCG2...	Monodelphis dom...
AAH57307	2.5e-175	85.5	1700021K19Rik p...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB002354	2.2e-12	22.7	KIAA0356

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMSmart IPR004012 108 168 SM00593 RUN

ProfileScan IPR004012 34 175 PS50826 RUN

Search method	interpro_ID	From	To	Entry	Definition
HMMSmart	IPR004012	108	168	SM00593	RUN
ProfileScan	IPR004012	34	175	PS50826	RUN

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: Northern blot Description

Northern blot	Description

RH mapping information	Description

Chromosome No.

: 3

Experimental conditions

Panel name	: Genebridge 4
Primer_f	: CGTTCTCTGCCAAGGATTTAG
Primer_r	: AGATGACAATGAACTGCCAGG
PCR product length	: 149 bp
PCR conditions	: 95 °C15 sec64 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	2377 bp
Genome contig ID	gi89161205r_198783253
PolyA signal sequence (AATAAA,-21)	+--------+--------+----*----+---- TAATAAACTAAGGAAATAAAATTCTGTCTTTCGTC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AGCCTGCCTTGACTGTCAAGAAATGGCATGTGTCCACTGTAAAGCAGGTA

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	3	r	198883253	198960656	22	99.8	Perfect prediction

Gene/Protein Characteristic Table for KIAA0226

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information