HUGE

Gene/Protein Characteristic Table for KIAA0223

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00468
Accession No. :	D86976
Description :	minor histocompatibility antigen HA-1.
HUGO Gene Name :	histocompatibility (minor) HA-1 (HMHA1)
Clone Name :	ha02995 [Vector Info]
Flexi ORF Clone :	pF1KSDA0223
Source :	Myeloblast cell line (KG-1)

Features of the cloned DNA sequence	Description

Length: 4121 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 622 bp

Genome contig ID gi42406306f_918317
PolyA signal sequence
(AATAAA,-21)
+----*----+----*----+----*----+----
GTTTATTTTGCTGAAATAAAAAGTTTTTAATCGGG
Flanking genome sequence
(119312 - 119361)
----+----*----+----*----+----*----+----*----+----*
TGTTTTCTGTGGCAGCTGCAAGCTTAGAAGATTTTCTGTGGCAGCTGCAA

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 19 f 1018317 1037627 23 100.0 Perfect prediction

Features of the protein sequence	Description

Length: 1165 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q92619	100.0	Minor histocomp...	Homo sapiens
AAH65223	99.7	Histocompatibil...	Homo sapiens
BAG62086	99.6	unnamed protein...	Homo sapiens
AAH35564	98.1	HMHA1 protein [...	Homo sapiens
Q5RB40	94.9	Minor histocomp...	Pongo abelii

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB040911	0.00037	29.4	KIAA1478

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR002219 732 779 PF00130 Protein kinase C

IPR000198 804 976 PF00620 RhoGAP

HMMSmart IPR001060 303 390 SM00055 Cdc15/Fes/CIP4

IPR002219 730 776 SM00109 Protein kinase C

IPR000198 801 1000 SM00324 RhoGAP

ProfileScan IPR002219 731 776 PS50081 Protein kinase C

IPR000198 790 1003 PS50238 RhoGAP

ScanRegExp IPR002219 732 776 PS00479 Protein kinase C

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR002219	732	779	PF00130	Protein kinase C
IPR000198	804	976	PF00620	RhoGAP
HMMSmart	IPR001060	303	390	SM00055	Cdc15/Fes/CIP4
IPR002219	730	776	SM00109	Protein kinase C
IPR000198	801	1000	SM00324	RhoGAP
ProfileScan	IPR002219	731	776	PS50081	Protein kinase C
IPR000198	790	1003	PS50238	RhoGAP
ScanRegExp	IPR002219	732	776	PS00479	Protein kinase C

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: Northern blot Description

Northern blot	Description

RH mapping information	Description

Chromosome No.

: 19

Experimental conditions

Panel name	: Genebridge 4
Primer_f	: AGTTTCCAGGGTGCAGTACAG
Primer_r	: AGACCCCACTGTGTACCTGAG
PCR product length	: 103 bp
PCR conditions	: 95 °C15 sec64 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	622 bp
Genome contig ID	gi42406306f_918317
PolyA signal sequence (AATAAA,-21)	+--------+--------+----*----+---- GTTTATTTTGCTGAAATAAAAAGTTTTTAATCGGG
Flanking genome sequence (119312 - 119361)	----+--------+--------+--------+--------+----* TGTTTTCTGTGGCAGCTGCAAGCTTAGAAGATTTTCTGTGGCAGCTGCAA

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	19	f	1018317	1037627	23	100.0	Perfect prediction

Gene/Protein Characteristic Table for KIAA0223

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information