HUGE |
Gene/Protein Characteristic Table for KIAA0217 |
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Expression | Mapping | |
Product ID : | ORK00464 |
---|---|
Accession No. : | D86971 |
Description : | La-related protein 5. |
HUGO Gene Name : | |
Clone Name : | ha04826s1 [Vector Info] |
Flexi ORF Clone : | pF1KSDA0217
![]() |
Source : | Myeloblast cell line (KG-1) |
Note : | We replaced ha04826, former representative clones for KIAA0217 with ha04826s1. (2002/5/10) |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 5640 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | NO |
Length of 3'UTR 3382 bp Genome contig ID gi89161187r_745484 PolyA signal sequence
(AATAAA,-22) +----*----+----*----+----*----+----
TGTAGGTTATGAAAATAAAGATTTAGGCACTGTTCFlanking genome sequence
(100000 - 99951) ----+----*----+----*----+----*----+----*----+----*
AATTTTTCTTTTGATTTTTTTTAAATTAAAATTTCTTCAATAATGCATCT
Chr f/r start end exon identity class ContigView(URL based/DAS) 10 r 845484 921702 17 99.3 Perfect prediction
Features of the protein sequence |
Description | |
---|---|---|
Length: 751 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
No significant homologues
Expression profile |
Description | |
---|---|---|
RH mapping information |
Description | |
---|---|---|
: 10 |
: Genebridge 4 | |
: ACAGGGCTGCAGACAATCGAG | |
: CATGTAAGCTTGATTCCAGTC | |
: 127 bp | |
: 95 °C |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage ![]() | |