HUGE

Gene/Protein Characteristic Table for KIAA0217

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00464
Accession No. :	D86971
Description :	La-related protein 5.
HUGO Gene Name :
Clone Name :	ha04826s1 [Vector Info]
Flexi ORF Clone :	pF1KSDA0217
Source :	Myeloblast cell line (KG-1)
Note :	We replaced ha04826, former representative clones for KIAA0217 with ha04826s1. (2002/5/10)

Features of the cloned DNA sequence	Description

Length: 5640 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 3382 bp

Genome contig ID gi89161187r_745484
PolyA signal sequence
(AATAAA,-22)
+----*----+----*----+----*----+----
TGTAGGTTATGAAAATAAAGATTTAGGCACTGTTC
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AATTTTTCTTTTGATTTTTTTTAAATTAAAATTTCTTCAATAATGCATCT

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 10 r 845484 921702 17 99.3 Perfect prediction

Features of the protein sequence	Description

Length: 751 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
XP_001137313	99.3	La ribonucleopr...	Pan troglodytes
Q92615	100.0	La-related prot...	Homo sapiens
XP_507619	99.3	La ribonucleopr...	Pan troglodytes
EAW86531	96.6	La ribonucleopr...	Homo sapiens
EDM06963	89.0	La ribonucleopr...	Rattus norvegicus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR006630 173 230 PF05383 RNA-binding protein Lupus La

HMMSmart IPR006630 167 245 SM00715 RNA-binding protein Lupus La

ProfileScan IPR006630 163 252 PS50961 RNA-binding protein Lupus La

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR006630	173	230	PF05383	RNA-binding protein Lupus La
HMMSmart	IPR006630	167	245	SM00715	RNA-binding protein Lupus La
ProfileScan	IPR006630	163	252	PS50961	RNA-binding protein Lupus La

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: Northern blot Description

Northern blot	Description

RH mapping information	Description

Chromosome No.

: 10

Experimental conditions

Panel name	: Genebridge 4
Primer_f	: ACAGGGCTGCAGACAATCGAG
Primer_r	: CATGTAAGCTTGATTCCAGTC
PCR product length	: 127 bp
PCR conditions	: 95 °C15 sec66 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	3382 bp
Genome contig ID	gi89161187r_745484
PolyA signal sequence (AATAAA,-22)	+--------+--------+----*----+---- TGTAGGTTATGAAAATAAAGATTTAGGCACTGTTC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AATTTTTCTTTTGATTTTTTTTAAATTAAAATTTCTTCAATAATGCATCT

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	10	r	845484	921702	17	99.3	Perfect prediction

Gene/Protein Characteristic Table for KIAA0217

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information