| HUGE |
Gene/Protein Characteristic Table for KIAA0199 |
|
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
| Features : DNA sequence | Protein sequence | Expression | Mapping | |
| Product ID : | ORK00453 |
|---|---|
| Accession No. : | D83782 |
| Description : | Sterol regulatory element-binding protein cleavage-activating protein. |
| HUGO Gene Name : | SREBF chaperone (SCAP) |
| Clone Name : | ha03150s1 [Vector Info] |
| Flexi ORF Clone : | pF1KSDA0199
![]() |
| Source : | Myeloblast cell line (KG-1) |
| Note : | We replaced ha03150, former representative clones for KIAA0199 with ha03150s1. (2002/5/10) |
Features of the cloned DNA sequence |
Description | |
|---|---|---|
Length: 4226 bp
|
| cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | NO |
Length of 3'UTR 141 bp Genome contig ID gi89161205r_47330207 PolyA signal sequence
(ATTAAA,-21) +----*----+----*----+----*----+----
CTGACTGTAATAATATTAAACTTTTTTAAAAAACCFlanking genome sequence
(100000 - 99951) ----+----*----+----*----+----*----+----*----+----*
ATATCATCATCTGTCAGGCACTTTGGGAGCTACTTGTGTCTCTTGGAATT
Chr f/r start end exon identity class ContigView(URL based/DAS) 3 r 47430207 47492439 23 100.0 Perfect prediction
Features of the protein sequence |
Description | |
|---|---|---|
Length: 1283 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
No significant homologues
Expression profile |
Description | |
|---|---|---|
RH mapping information |
Description | |
|---|---|---|
| : 3 |
| : Genebridge 4 | |
| : GCCTGGTGTATGTGCCCTCTG | |
| : CGGCTGGAAGATACTCGGCTC | |
| : 140 bp | |
| : 95 °C |
|
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage
| |