| HUGE | 
Gene/Protein Characteristic Table for KIAA0195 | 
| 
Link to : 
Rouge | 
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
| Features : DNA sequence | Protein sequence | Expression | Mapping | |
| Product ID : | ORK00451 | 
|---|---|
| Accession No. : | D83779 | 
| Description : | |
| HUGO Gene Name : | |
| Clone Name : | ha02752 [Vector Info] | 
| Flexi ORF Clone : | pF1KSDA0195
                   ![]()  | 
| Source : | Myeloblast cell line (KG-1) | 
Features of the cloned DNA sequence | 
Description | |
|---|---|---|
Length: 5022 bp
 
       | 
| cloned DNA seq. | |
Warning for N-terminal truncation:  | NO | 
Warning for coding interruption:  | NO | 
Length of 3'UTR 748 bp Genome contig ID gi51511734f_70864331 PolyA signal sequence 
(ATTAAA,-20) +----*----+----*----+----*----+----
TGTAGACTGGTTTGTATTAAAATGTGTCAATTGCTFlanking genome sequence 
(143429 - 143478) ----+----*----+----*----+----*----+----*----+----*
AAGAAATACCTGTGGCTGGTCTGTAAGGCCACTCCAGGGTCTGCCCACCC
Chr f/r start end exon identity class ContigView(URL based/DAS) 17 f 70964331 71007758 32 99.9 Perfect prediction 
Features of the protein sequence | 
Description | |
|---|---|---|
Length: 1410 aa
![]()  | 
        
        
  | 
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
No significant homologues
    Expression profile | 
Description | |
|---|---|---|
RH mapping information | 
Description | |
|---|---|---|
| : 17 | 
| : Stanford G3 | |
| : GTCTCCCGCCTGAACCTGAAG | |
| : AGATTCCCCAAGACTGACAGG | |
| : 102 bp | |
| : 95 °C | 
| 
 
 How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage  
 
  | |