HUGE

Gene/Protein Characteristic Table for KIAA0193

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00450
Accession No. :	D83777
Description :	Secernin-1.
HUGO Gene Name :	secernin 1 (SCRN1)
Clone Name :	bh00167 [Vector Info]
Flexi ORF Clone :	pF1KSDA0193
Source :	Human adult brain
Note :	We replaced ha02308, former representative clones for KIAA0193 with bh00167. (2002/5/10)

Features of the cloned DNA sequence	Description

Length: 5203 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
YES

Integrity of 3' end

Length of 3'UTR 3844 bp

Genome contig ID gi89161213r_29826268
PolyA signal sequence
(AATAAA,-19)
+----*----+----*----+----*----+----
AATGCATCAAGCATACAATAAAAAAAACTGAAATT
Flanking genome sequence
(99984 - 99935)
----+----*----+----*----+----*----+----*----+----*
AACATCCAGTGGAGTGGCCTCTTCTGTTTTGTGTCTCGTGAATAAACGTG

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 7 r 29926252 29995895 8 99.2 Perfect prediction

Features of the protein sequence	Description

Length: 443 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
Q12765	8e-181	100.0	Secernin-1.	Homo sapiens
BAG58182	1.5e-180	99.8	unnamed protein...	Homo sapiens
AAH40492	5.1e-180	99.8	Secernin 1 [Hom...	Homo sapiens
XP_519021	2.2e-177	98.3	secernin 1 [Pan...	Pan troglodytes
XP_001499496	1.7e-168	89.3	similar to Sece...	Equus caballus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR005322 38 388 PF03577 Peptidase C69

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR005322	38	388	PF03577	Peptidase C69

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: Northern blot Description

Northern blot	Description

RH mapping information	Description

Chromosome No.

: 7

Experimental conditions

Panel name	: Genebridge 4
Primer_f	: TGTCATTTATTGGGGAAGGTC
Primer_r	: GACTGTGCAGAATGAAAAGCC
PCR product length	: 188 bp
PCR conditions	: 95 °C15 sec62 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	YES

Length of 3'UTR	3844 bp
Genome contig ID	gi89161213r_29826268
PolyA signal sequence (AATAAA,-19)	+--------+--------+----*----+---- AATGCATCAAGCATACAATAAAAAAAACTGAAATT
Flanking genome sequence (99984 - 99935)	----+--------+--------+--------+--------+----* AACATCCAGTGGAGTGGCCTCTTCTGTTTTGTGTCTCGTGAATAAACGTG

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	7	r	29926252	29995895	8	99.2	Perfect prediction

Gene/Protein Characteristic Table for KIAA0193

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information