| HUGE |
Gene/Protein Characteristic Table for KIAA0184 |
|
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
| Features : DNA sequence | Protein sequence | Expression | Mapping | |
| Product ID : | ORK04775 |
|---|---|
| Accession No. : | D80006 |
| Description : | Disco-interacting protein 2 homolog A. |
| HUGO Gene Name : | DIP2 disco-interacting protein 2 homolog A (Drosophila) (DIP2A) |
| Clone Name : | ha02918 [Vector Info] |
| Source : | Myeloblast cell line (KG-1) |
Features of the cloned DNA sequence |
Description | |
|---|---|---|
Length: 4639 bp
|
| cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | NO |
Features of the protein sequence |
Description | |
|---|---|---|
Length: 863 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Expression profile |
Description | |
|---|---|---|
RH mapping information |
Description | |
|---|---|---|
| : 2 |
| : Genebridge 4 | |
| : GGCACATTATTTCCCCCTGAG | |
| : CCCAAGGCCTTTTACAGTCTG | |
| : 141 bp | |
| : 95 °C |
|
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage
| |