| HUGE |
Gene/Protein Characteristic Table for KIAA0180 |
|
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
| Features : DNA sequence | Protein sequence | Expression | Mapping | |
| Product ID : | ORK00446 |
|---|---|
| Accession No. : | D80002 |
| Description : | GDP-fucose protein O-fucosyltransferase 1 precursor. |
| HUGO Gene Name : | protein O-fucosyltransferase 1 (POFUT1) |
| Clone Name : | ha02567s1 [Vector Info] |
| Flexi ORF Clone : | pF1KSDA0180
![]() |
| Source : | Myeloblast cell line (KG-1) |
| Note : | We replaced ha02567, former representative clones for KIAA0180 with ha02567s1. (2002/5/10) |
Features of the cloned DNA sequence |
Description | |
|---|---|---|
Length: 5189 bp
|
| cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | NO |
Length of 3'UTR 3976 bp Genome contig ID gi51511747f_30159360 PolyA signal sequence
(AATAAA,-9) +----*----+----*----+----*----+----
TCAAATATAAATAAAAAATTGTGAGTAATAAAATGFlanking genome sequence
(130743 - 130792) ----+----*----+----*----+----*----+----*----+----*
AACTCACAGTTTCAACAATGACCCACATTTTACCAGTCTAGTTGCATTGA
Chr f/r start end exon identity class ContigView(URL based/DAS) 20 f 30259360 30290101 7 100.0 Perfect prediction
Features of the protein sequence |
Description | |
|---|---|---|
Length: 403 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
No significant homologues
Expression profile |
Description | |
|---|---|---|
RH mapping information |
Description | |
|---|---|---|
| : 20 |
| : Genebridge 4 | |
| : AAGGAGGTGGGAAATGATTAG | |
| : AACAGGGAAAACATGATACAC | |
| : 150 bp | |
| : 95 °C |
|
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage
| |