HUGE

Gene/Protein Characteristic Table for KIAA0171

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00442
Accession No. :	D79993
Description :	EPN4_HUMAN Isoform 2 of Q14677 - Homo sapiens.
HUGO Gene Name :	clathrin interactor 1 (CLINT1)
Clone Name :	ha02502 [Vector Info]
Flexi ORF Clone :	pF1KSDA0171
Source :	Myeloblast cell line (KG-1)

Features of the cloned DNA sequence	Description

Length: 3336 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 1357 bp

Genome contig ID gi51511721r_157045875
PolyA signal sequence
(ATTAAA,-9)
+----*----+----*----+----*----+----
CTGTTATACATAACATTAAAATGTTCATTAAAATC
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AATGTTGAACTGCTTTTTCTTTCGTTCTGTTAGACATTTGAGACCATTTG

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 5 r 157145875 157218657 12 100.0 Perfect prediction

Features of the protein sequence	Description

Length: 655 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
CAI25020	2.7e-198	94.4	clathrin intera...	Mus musculus
BAE25429	4.3e-198	94.2	unnamed protein...	Mus musculus
BAE28195	8.8e-197	93.6	unnamed protein...	Mus musculus
XP_001138881	3.8e-196	94.5	epsin 4 isoform...	Pan troglodytes
XP_001068435	4.7e-195	94.4	similar to Epsi...	Rattus norvegicus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB028988	5.6e-15	27.2	KIAA1065

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR001026 51 175 PF01417 Epsin

HMMSmart IPR013809 52 179 SM00273 Epsin-like

ProfileScan IPR013809 46 179 PS50942 Epsin-like

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001026	51	175	PF01417	Epsin
HMMSmart	IPR013809	52	179	SM00273	Epsin-like
ProfileScan	IPR013809	46	179	PS50942	Epsin-like

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: Northern blot Description

Northern blot	Description

RH mapping information	Description

Chromosome No.

: 5

Experimental conditions

Panel name	: Stanford G3
Primer_f	: TTTTTCAGGACTGCTCTATGG
Primer_r	: TACAGGGATAAACACGGAAGG
PCR product length	: 122 bp
PCR conditions	: 95 °C15 sec62 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	1357 bp
Genome contig ID	gi51511721r_157045875
PolyA signal sequence (ATTAAA,-9)	+--------+--------+----*----+---- CTGTTATACATAACATTAAAATGTTCATTAAAATC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AATGTTGAACTGCTTTTTCTTTCGTTCTGTTAGACATTTGAGACCATTTG

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	5	r	157145875	157218657	12	100.0	Perfect prediction

Gene/Protein Characteristic Table for KIAA0171

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information