HUGE

Gene/Protein Characteristic Table for KIAA0164

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00033
Accession No. :	D79986
Description :	Bcl-2-associated transcription factor 1.
HUGO Gene Name :	BCL2-associated transcription factor 1 (BCLAF1)
Clone Name :	ha02373 [Vector Info]
Flexi ORF Clone :	pF1KA0164
Source :	Myeloblast cell line (KG-1)

Features of the cloned DNA sequence	Description

Length: 5538 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 2522 bp

Genome contig ID gi89161210r_136521419
PolyA signal sequence
(AATAAA,-20)
+----*----+----*----+----*----+----
AAATTGTCATACGCCAATAAAATGTCACAAGTAAT
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AACTGCTGTTGTTTGTTTACCTGTGTCTATTTCACACATCTTATTTCTGT

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 6 r 136621419 136652682 13 100.0 Perfect prediction

Features of the protein sequence	Description

Length: 929 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q9NYF8	100.0	Bcl-2-associate...	Homo sapiens
XP_001170895	99.9	BCL2-associated...	Pan troglodytes
XP_518759	99.9	BCL2-associated...	Pan troglodytes
AAI44282	99.8	BCLAF1 protein ...	Homo sapiens
XP_849956	98.4	similar to Bcl-...	Canis lupus fam...

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB002322	1.1e-05	24.5	KIAA0324

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

Motif_DB interpro_ID From To Entry Definition

None - - - - -

Motif_DB	interpro_ID	From	To	Entry	Definition
None	-	-	-	-	-

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: Northern blot Description

Northern blot	Description

RH mapping information	Description

Chromosome No.

: 6

Experimental conditions

Panel name	: Stanford G3
Primer_f	: AATAACTCACTGATACCTGCG
Primer_r	: ACACACCTAAAGAGTCATGGC
PCR product length	: 129 bp
PCR conditions	: 95 °C15 sec62 °C120 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	2522 bp
Genome contig ID	gi89161210r_136521419
PolyA signal sequence (AATAAA,-20)	+--------+--------+----*----+---- AAATTGTCATACGCCAATAAAATGTCACAAGTAAT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AACTGCTGTTGTTTGTTTACCTGTGTCTATTTCACACATCTTATTTCTGT

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	6	r	136621419	136652682	13	100.0	Perfect prediction

Gene/Protein Characteristic Table for KIAA0164

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information