HUGE

Gene/Protein Characteristic Table for KIAA0162

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK07029
Accession No. :	D79984
Description :	Transcription elongation factor SPT6.
HUGO Gene Name :	suppressor of Ty 6 homolog (S. cerevisiae) (SUPT6H)
Clone Name :	ha03982 [Vector Info]
Flexi ORF Clone :	pF1KA0162
Source :	Myeloblast cell line (KG-1)

Features of the cloned DNA sequence	Description

Length: 5876 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 605 bp

Genome contig ID gi51511734f_23913429
PolyA signal sequence
(AATAAA,-20)
+----*----+----*----+----*----+----
CCTGCCTGTCATTTGAATAAACAGTGTTTCTATTG
Flanking genome sequence
(139948 - 139997)
----+----*----+----*----+----*----+----*----+----*
AGCTCTTGCCAAAGCCTCTCTCTCCAACTCTCCAGCTCTTTGAGGGGTGG

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 17 f 24013429 24053375 37 99.9 Perfect prediction

Features of the protein sequence	Description

Length: 1730 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q7KZ85	100.0	Transcription e...	Homo sapiens
XP_001142885	99.8	similar to puta...	Pan troglodytes
XP_537747	99.7	similar to supp...	Canis lupus fam...
XP_001504206	99.5	suppressor of T...	Equus caballus
XP_873999	99.0	similar to supp...	Bos taurus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR003029 1235 1286 PF00575 S1

IPR000980 1339 1419 PF00017 SH2 motif

HMMSmart IPR006641 783 898 SM00732 Resolvase

IPR003029 1225 1286 SM00316 S1

IPR000980 1336 1425 SM00252 SH2 motif

ProfileScan IPR003029 1231 1286 PS50126 S1

IPR000980 1329 1435 PS50001 SH2 motif

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR003029	1235	1286	PF00575	S1
IPR000980	1339	1419	PF00017	SH2 motif
HMMSmart	IPR006641	783	898	SM00732	Resolvase
IPR003029	1225	1286	SM00316	S1
IPR000980	1336	1425	SM00252	SH2 motif
ProfileScan	IPR003029	1231	1286	PS50126	S1
IPR000980	1329	1435	PS50001	SH2 motif

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: Northern blot Description

Northern blot	Description

RH mapping information	Description

Chromosome No.

: 17

Experimental conditions

Panel name	: Stanford G3
Primer_f	: TTATTCAGTTTGGGGCAGGAG
Primer_r	: TCAAATGACAGGCAGGAAGCG
PCR product length	: 171 bp
PCR conditions	: 95 °C15 sec64 °C120 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	605 bp
Genome contig ID	gi51511734f_23913429
PolyA signal sequence (AATAAA,-20)	+--------+--------+----*----+---- CCTGCCTGTCATTTGAATAAACAGTGTTTCTATTG
Flanking genome sequence (139948 - 139997)	----+--------+--------+--------+--------+----* AGCTCTTGCCAAAGCCTCTCTCTCCAACTCTCCAGCTCTTTGAGGGGTGG

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	17	f	24013429	24053375	37	99.9	Perfect prediction

Gene/Protein Characteristic Table for KIAA0162

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information