HUGE

Gene/Protein Characteristic Table for KIAA0159

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00032
Accession No. :	D63880
Description :	Condensin complex subunit 1.
HUGO Gene Name :	non-SMC condensin I complex, subunit D2 (NCAPD2)
Clone Name :	ha03574 [Vector Info]
Flexi ORF Clone :	pF1KA0159
Source :	Myeloblast cell line (KG-1)

Features of the cloned DNA sequence	Description

Length: 5547 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 542 bp

Genome contig ID gi89161190f_6372806
PolyA signal sequence
(AATAAA,-23)
+----*----+----*----+----*----+----
TGTTTTCTAATGAATAAATGTTTTTATATACTTTT
Flanking genome sequence
(138577 - 138626)
----+----*----+----*----+----*----+----*----+----*
AGACATTTTTTCCTAAGCTTGTCTTTGTTTCATCTTTCACATTAGCCCAG

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 12 f 6472806 6511381 32 99.7 Perfect prediction

Features of the protein sequence	Description

Length: 1406 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAG11144	100.0	condensin compl...	synthetic construct
EAW88788	99.9	chromosome cond...	Homo sapiens
Q15021	99.8	Condensin compl...	Homo sapiens
NP_055680	99.8	non-SMC condens...	Homo sapiens
XP_001161617	99.6	chromosome cond...	Pan troglodytes

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
D29954	1.1e-05	22.8	KIAA0056

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR000357 364 400 PF02985 HEAT

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR000357	364	400	PF02985	HEAT

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: Northern blot Description

Northern blot	Description

RH mapping information	Description

Chromosome No.

: 12

Experimental conditions

Panel name	: Stanford G3
Primer_f	: GACTCGTCGCTAAGATTCCCC
Primer_r	: CAACCTTCATTTCCTTCACGG
PCR product length	: 96 bp
PCR conditions	: 95 °C15 sec62 °C120 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	542 bp
Genome contig ID	gi89161190f_6372806
PolyA signal sequence (AATAAA,-23)	+--------+--------+----*----+---- TGTTTTCTAATGAATAAATGTTTTTATATACTTTT
Flanking genome sequence (138577 - 138626)	----+--------+--------+--------+--------+----* AGACATTTTTTCCTAAGCTTGTCTTTGTTTCATCTTTCACATTAGCCCAG

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	12	f	6472806	6511381	32	99.7	Perfect prediction

Gene/Protein Characteristic Table for KIAA0159

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information