HUGE |
Gene/Protein Characteristic Table for KIAA0150 |
Link to :
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Expression | Mapping | |
Product ID : | ORK00430 |
---|---|
Accession No. : | D63484 |
Description : | Zinc finger CCCH domain-containing protein 3. |
HUGO Gene Name : | zinc finger CCCH-type containing 3 (ZC3H3) |
Clone Name : | ha01348 [Vector Info] |
Flexi ORF Clone : | pF1KSDA0150
![]() |
Source : | Myeloblast cell line (KG-1) |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 3231 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | NO |
Length of 3'UTR 395 bp Genome contig ID gi51511724r_144490974 PolyA signal sequence
(AATAAA,-18) +----*----+----*----+----*----+----
GGTGTTTTATGTTCAGCAATAAAGGTTCTATCCGTFlanking genome sequence
(100000 - 99951) ----+----*----+----*----+----*----+----*----+----*
AACTGGTTGGCTTGTCCTGACTGTTGCCATGCCACCGCCAGGCGGAAAGC
Chr f/r start end exon identity class ContigView(URL based/DAS) 8 r 144590974 144694723 12 99.6 Perfect prediction
Features of the protein sequence |
Description | |
---|---|---|
Length: 944 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
No significant homologues
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
HMMPfam | IPR000571 | 664 | 690 | PF00642 | Zinc finger |
IPR000571 | 691 | 717 | PF00642 | Zinc finger | |
IPR000571 | 720 | 744 | PF00642 | Zinc finger | |
IPR000571 | 747 | 772 | PF00642 | Zinc finger | |
IPR000571 | 773 | 795 | PF00642 | Zinc finger | |
HMMSmart | IPR000571 | 664 | 690 | SM00356 | Zinc finger |
IPR000571 | 691 | 717 | SM00356 | Zinc finger | |
IPR000571 | 719 | 744 | SM00356 | Zinc finger | |
IPR000571 | 746 | 772 | SM00356 | Zinc finger | |
IPR000571 | 773 | 795 | SM00356 | Zinc finger |
Method | No. | N terminal | transmembrane region | C terminal | type | length |
---|---|---|---|---|---|---|
- | - | - | - | - | - | - |
Expression profile |
Description | |
---|---|---|
RH mapping information |
Description | |
---|---|---|
: 8 |
: Genebridge 4 | |
: GATGACTACAAAACCCTCCAC | |
: CACGAGGGAGTATTTCTTGCG | |
: 177 bp | |
: 95 °C |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage ![]() | |