HUGE

Gene/Protein Characteristic Table for KIAA0144

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00028
Accession No. :	D63478
Description :	Ubiquitin-associated protein 2-like.
HUGO Gene Name :	ubiquitin associated protein 2-like (UBAP2L)
Clone Name :	ha03843 [Vector Info]
Flexi ORF Clone :	pF1KA0144
Source :	Myeloblast cell line (KG-1)

Features of the cloned DNA sequence	Description

Length: 3411 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 353 bp

Genome contig ID gi89161185f_152359279
PolyA signal sequence
(AATAAA,-28)
+----*----+----*----+----*----+----
AGTCTTCAATAAACTGTGGTATTTCTTTAGCTAAC
Flanking genome sequence
(143328 - 143377)
----+----*----+----*----+----*----+----*----+----*
TCTGGCGTTCTTTCCGTGCATGTCTTTGTGGACACTAGGAACCAATGCTG

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 1 f 152459279 152502605 25 100.0 Perfect prediction

Features of the protein sequence	Description

Length: 983 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
XP_001113998	99.9	ubiquitin assoc...	Macaca mulatta
AAI48080	98.7	UBAP2L protein ...	Bos taurus
ABM06060	98.7	ubiquitin assoc...	Bos taurus
BAG64560	99.1	unnamed protein...	Homo sapiens
EDL15170	98.1	ubiquitin assoc...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB040924	9e-26	47.1	KIAA1491

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR000449 49 89 PF00627 Ubiquitin-associated/Translation elongation factor EF1B

HMMSmart IPR000449 50 88 SM00165 Ubiquitin-associated/Translation elongation factor EF1B

ProfileScan IPR000449 49 89 PS50030 Ubiquitin-associated/Translation elongation factor EF1B

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR000449	49	89	PF00627	Ubiquitin-associated/Translation elongation factor EF1B
HMMSmart	IPR000449	50	88	SM00165	Ubiquitin-associated/Translation elongation factor EF1B
ProfileScan	IPR000449	49	89	PS50030	Ubiquitin-associated/Translation elongation factor EF1B

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: Northern blot Description

Northern blot	Description

RH mapping information	Description

Chromosome No.

: 12

Experimental conditions

Panel name	: Genebridge 4
Primer_f	: ACTTAAACTCCCACCTACTCC
Primer_r	: TGAGGTTGTTCCCAGTTTCCC
PCR product length	: 147 bp
PCR conditions	: 95 °C15 sec64 °C120 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	353 bp
Genome contig ID	gi89161185f_152359279
PolyA signal sequence (AATAAA,-28)	+--------+--------+----*----+---- AGTCTTCAATAAACTGTGGTATTTCTTTAGCTAAC
Flanking genome sequence (143328 - 143377)	----+--------+--------+--------+--------+----* TCTGGCGTTCTTTCCGTGCATGTCTTTGTGGACACTAGGAACCAATGCTG

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	1	f	152459279	152502605	25	100.0	Perfect prediction

Gene/Protein Characteristic Table for KIAA0144

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information