HUGE

Gene/Protein Characteristic Table for KIAA0118

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK06560
Accession No. :	D42087
Description :	Ras-related protein Rab-21.
HUGO Gene Name :	RAB21, member RAS oncogene family (RAB21)
Clone Name :	ha00793 [Vector Info]
Source :	Myeloblast cell line (KG-1)

Features of the cloned DNA sequence	Description

Length: 1413 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 927 bp

Genome contig ID gi89161190f_70350638
PolyA signal sequence
(None)
+----*----+----*----+----*----+----
TTATCTGCTTTTACAAGCGCAAGGTGCAAAAATAT
Flanking genome sequence
(116011 - 116060)
----+----*----+----*----+----*----+----*----+----*
ATACAATAGTCTCATTGATGACTGTAAAGTGAATTAACATTTGGTGATTA

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 12 f 70449880 70466647 6 100.0 Perfect prediction

Features of the protein sequence	Description

Length: 161 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
XP_001117520	2e-66	100.0	similar to Ras-...	Macaca mulatta
XP_522469	2e-66	100.0	similar to GTP-...	Pan troglodytes
Q9UL25	2e-66	100.0	Ras-related pro...	Homo sapiens
P55745	7.2e-66	98.8	Ras-related pro...	Canis lupus fam...
XP_001490458	1.4e-65	98.1	similar to RAB2...	Equus caballus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

FPrintScan IPR001806 59 72 PR00449 Ras GTPase

IPR001806 94 116 PR00449 Ras GTPase

HMMPfam IPR013753 1 118 PF00071 Ras

HMMSmart IPR003578 1 119 SM00174 Ras small GTPase

IPR003577 1 119 SM00173 Ras small GTPase

IPR003579 1 119 SM00175 Ras small GTPase

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR001806	59	72	PR00449	Ras GTPase
IPR001806	94	116	PR00449	Ras GTPase
HMMPfam	IPR013753	1	118	PF00071	Ras
HMMSmart	IPR003578	1	119	SM00174	Ras small GTPase
IPR003577	1	119	SM00173	Ras small GTPase
IPR003579	1	119	SM00175	Ras small GTPase

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: Northern blot Description

Northern blot	Description

RH mapping information	Description

Chromosome No.

: 12

Experimental conditions

Panel name	: Genebridge 4
Primer_f	: TGATAGAAACAGCACAAGTGG
Primer_r	: TCCTGGCTAACCTGGTGAAAC
PCR product length	: 582 bp
PCR conditions	: 95 °C15 sec64 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	927 bp
Genome contig ID	gi89161190f_70350638
PolyA signal sequence (None)	+--------+--------+----*----+---- TTATCTGCTTTTACAAGCGCAAGGTGCAAAAATAT
Flanking genome sequence (116011 - 116060)	----+--------+--------+--------+--------+----* ATACAATAGTCTCATTGATGACTGTAAAGTGAATTAACATTTGGTGATTA

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	12	f	70449880	70466647	6	100.0	Perfect prediction

Gene/Protein Characteristic Table for KIAA0118

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information