HUGE

Gene/Protein Characteristic Table for KIAA0113

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00020
Accession No. :	D30755
Description :	Nef-associated factor 1.
HUGO Gene Name :	TNFAIP3 interacting protein 1 (TNIP1)
Clone Name :	ha01652s1 [Vector Info]
Flexi ORF Clone :	pF1KA0113
Source :	Myeloblast cell line (KG-1)
Note :	We replaced ha01652, former representative clones for KIAA0113 with ha01652s1. (2002/5/10)

Features of the cloned DNA sequence	Description

Length: 2677 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 766 bp

Genome contig ID gi51511721r_150289701
PolyA signal sequence
(CATAAA,-24)
+----*----+----*----+----*----+----
CGAATCATGGACATAAATCCAAGTTGAAGAAGATC
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AACATTCTGACTCATGTTCATTTATGCGCTAATGTTCCCCTGTCAACCCC

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 5 r 150389701 150424849 17 99.7 Perfect prediction

Features of the protein sequence	Description

Length: 636 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
AAG42154	3.5e-187	99.8	virion-associat...	Homo sapiens
AAH12133	4.8e-187	99.8	TNFAIP3 interac...	Homo sapiens
XP_001167590	1.6e-186	99.5	Nef-associated ...	Pan troglodytes
BAF83688	2.1e-186	99.5	unnamed protein...	Homo sapiens
BAF48799	5.3e-185	100.0	Nef-associated ...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output)
No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

Motif_DB interpro_ID From To Entry Definition

None - - - - -

Motif_DB	interpro_ID	From	To	Entry	Definition
None	-	-	-	-	-

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: Northern blot Description

Northern blot	Description

RH mapping information	Description

Chromosome No.

: 5

Experimental conditions

Panel name	: Stanford G3
Primer_f	: CCCCTTCCTTCAAAACCTCCC
Primer_r	: AGACAAACCCACACTTCCCAC
PCR product length	: 159 bp
PCR conditions	: 95 °C15 sec66 °C120 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	766 bp
Genome contig ID	gi51511721r_150289701
PolyA signal sequence (CATAAA,-24)	+--------+--------+----*----+---- CGAATCATGGACATAAATCCAAGTTGAAGAAGATC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AACATTCTGACTCATGTTCATTTATGCGCTAATGTTCCCCTGTCAACCCC

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	5	r	150389701	150424849	17	99.7	Perfect prediction

Gene/Protein Characteristic Table for KIAA0113

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information