HUGE

Gene/Protein Characteristic Table for KIAA0106

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00410
Accession No. :	D14662
Description :	Peroxiredoxin-6.
HUGO Gene Name :	peroxiredoxin 6 (PRDX6)
Clone Name :	ha00683 [Vector Info]
Flexi ORF Clone :	pF1KSDA0106
Source :	Myeloblast cell line (KG-1)

Features of the cloned DNA sequence	Description

Length: 1653 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 935 bp

Genome contig ID gi89161185f_171613117
PolyA signal sequence
(AATAAA,-16)
+----*----+----*----+----*----+----
TTTACTTTTTAGGGAACAAAATAAAATCCTTTGTT
Flanking genome sequence
(111445 - 111494)
----+----*----+----*----+----*----+----*----+----*
AAAACTGGGTCAGAGAATTCTGTTGTCATATTTTGAAGTATCAGATTTAT

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 1 f 171713117 171724560 5 99.4 Perfect prediction

Features of the protein sequence	Description

Length: 238 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
Q5R7E0	7.6e-97	99.1	Peroxiredoxin-6.	Pongo abelii
XP_001101473	1.5e-96	98.7	peroxiredoxin 6...	Macaca mulatta
Q2PFL9	3.9e-96	98.2	Peroxiredoxin-6.	Macaca fascicularis
1PRX	1.2e-95	99.1	HORF6 A NOVEL H...	Homo sapiens
O77834	7.2e-94	95.1	Peroxiredoxin-6...	Bos taurus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR000866 21 160 PF00578 Alkyl hydroperoxide reductase/ Thiol specific antioxidant/ Mal allergen

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR000866	21	160	PF00578	Alkyl hydroperoxide reductase/ Thiol specific antioxidant/ Mal allergen

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: Northern blot Description

Northern blot	Description

RH mapping information	Description

Chromosome No.

: 1

Experimental conditions

Panel name	: Genebridge 4
Primer_f	: TGAAGAGCAGGGAAAGAGACC
Primer_r	: ATTGCTCACACCTGCTACACC
PCR product length	: 129 bp
PCR conditions	: 95 °C15 sec62 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	935 bp
Genome contig ID	gi89161185f_171613117
PolyA signal sequence (AATAAA,-16)	+--------+--------+----*----+---- TTTACTTTTTAGGGAACAAAATAAAATCCTTTGTT
Flanking genome sequence (111445 - 111494)	----+--------+--------+--------+--------+----* AAAACTGGGTCAGAGAATTCTGTTGTCATATTTTGAAGTATCAGATTTAT

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	1	f	171713117	171724560	5	99.4	Perfect prediction

Gene/Protein Characteristic Table for KIAA0106

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information