HUGE

Gene/Protein Characteristic Table for KIAA0103

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00017
Accession No. :	D14659
Description :	Tetratricopeptide repeat protein 35.
HUGO Gene Name :
Clone Name :	ha00802 [Vector Info]
Flexi ORF Clone :	pF1KA0103
Source :	Myeloblast cell line (KG-1)

Features of the cloned DNA sequence	Description

Length: 1219 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 319 bp

Genome contig ID gi51511724f_109425058
PolyA signal sequence
(AATAAA,-29)
+----*----+----*----+----*----+----
TTGTTAAATAAACCATGATGATTTATTAAACTTGC
Flanking genome sequence
(143266 - 143315)
----+----*----+----*----+----*----+----*----+----*
ATATGAAGATTCTAACTTCATTTTGTTATACTCACAGTGGATATATTGTT

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 8 f 109525058 109568322 11 100.0 Perfect prediction

Features of the protein sequence	Description

Length: 299 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
XP_001090826	7.7e-118	99.7	hypothetical pr...	Macaca mulatta
Q5R882	1.4e-117	99.7	Tetratricopepti...	Pongo abelii
AAH20753	1.6e-117	99.7	Tetratricopepti...	Homo sapiens
BAF83663	1.6e-117	99.7	unnamed protein...	Homo sapiens
XP_001495024	1.3e-116	99.3	similar to Tetr...	Equus caballus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR013105 89 122 PF07719 Tetratricopeptide TPR_2

IPR013105 157 190 PF07719 Tetratricopeptide TPR_2

HMMSmart IPR013026 89 122 SM00028 Tetratricopeptide region

IPR013026 157 190 SM00028 Tetratricopeptide region

IPR013026 194 227 SM00028 Tetratricopeptide region

ProfileScan IPR013026 89 122 PS50005 Tetratricopeptide region

IPR013026 89 227 PS50293 Tetratricopeptide region

IPR013026 157 190 PS50005 Tetratricopeptide region

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR013105	89	122	PF07719	Tetratricopeptide TPR_2
IPR013105	157	190	PF07719	Tetratricopeptide TPR_2
HMMSmart	IPR013026	89	122	SM00028	Tetratricopeptide region
IPR013026	157	190	SM00028	Tetratricopeptide region
IPR013026	194	227	SM00028	Tetratricopeptide region
ProfileScan	IPR013026	89	122	PS50005	Tetratricopeptide region
IPR013026	89	227	PS50293	Tetratricopeptide region
IPR013026	157	190	PS50005	Tetratricopeptide region

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: Northern blot Description

Northern blot	Description

RH mapping information	Description

Chromosome No.

: 8

Experimental conditions

Panel name	: Genebridge 4
Primer_f	: CATTAGATTTCACAACTGCAC
Primer_r	: CTCTCTTCCATGGATTTCCCC
PCR product length	: 184 bp
PCR conditions	: 95 °C15 sec62 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	319 bp
Genome contig ID	gi51511724f_109425058
PolyA signal sequence (AATAAA,-29)	+--------+--------+----*----+---- TTGTTAAATAAACCATGATGATTTATTAAACTTGC
Flanking genome sequence (143266 - 143315)	----+--------+--------+--------+--------+----* ATATGAAGATTCTAACTTCATTTTGTTATACTCACAGTGGATATATTGTT

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	8	f	109525058	109568322	11	100.0	Perfect prediction

Gene/Protein Characteristic Table for KIAA0103

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information