HUGE

Gene/Protein Characteristic Table for KIAA0095

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00015
Accession No. :	D42085
Description :	Nuclear pore complex protein Nup93.
HUGO Gene Name :	nucleoporin 93kDa (NUP93)
Clone Name :	ha01471 [Vector Info]
Flexi ORF Clone :	pF1KA0095
Source :	Myeloblast cell line (KG-1)

Features of the cloned DNA sequence	Description

Length: 2681 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 155 bp

Genome contig ID gi51511732f_55221573
PolyA signal sequence
(AATAAA,-20)
+----*----+----*----+----*----+----
ATTTTTGTCAACGCCAATAAATTTCTTTGATTTGT
Flanking genome sequence
(214606 - 214655)
----+----*----+----*----+----*----+----*----+----*
ATTTCTTTTCAACATTCTTTTATTTTCTTTTTTTTTTTCTTTGAAATTTT

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 16 f 55321573 55436177 22 99.9 Perfect prediction

Features of the protein sequence	Description

Length: 832 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
XP_510982	99.9	nucleoporin 93k...	Pan troglodytes
Q8N1F7	100.0	Nuclear pore co...	Homo sapiens
AAH34346	99.9	Nucleoporin 93k...	Homo sapiens
BAF84951	99.8	unnamed protein...	Homo sapiens
Q5R822	99.5	Nuclear pore co...	Pongo abelii

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR007231 244 518 PF04097 Nucleoporin interacting component

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR007231	244	518	PF04097	Nucleoporin interacting component

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: Northern blot Description

Northern blot	Description

RH mapping information	Description

Chromosome No.

: 16

Experimental conditions

Panel name	: Stanford G3
Primer_f	: ACAAGTCCATCCTCGTCATCC
Primer_r	: ACAAAACCAGAAACCCCAGCC
PCR product length	: 250 (3.0k) bp
PCR conditions	: 95 °C15 sec66 °C120 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	155 bp
Genome contig ID	gi51511732f_55221573
PolyA signal sequence (AATAAA,-20)	+--------+--------+----*----+---- ATTTTTGTCAACGCCAATAAATTTCTTTGATTTGT
Flanking genome sequence (214606 - 214655)	----+--------+--------+--------+--------+----* ATTTCTTTTCAACATTCTTTTATTTTCTTTTTTTTTTTCTTTGAAATTTT

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	16	f	55321573	55436177	22	99.9	Perfect prediction

Gene/Protein Characteristic Table for KIAA0095

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information