HUGE |
Gene/Protein Characteristic Table for KIAA0094 |
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Expression | Mapping | |
Product ID : | ORK00014 |
---|---|
Accession No. : | D42084 |
Description : | Methionine aminopeptidase 1. |
HUGO Gene Name : | methionyl aminopeptidase 1 (METAP1) |
Clone Name : | ha01451 [Vector Info] |
Flexi ORF Clone : | pF1KA0094
![]() |
Source : | Myeloblast cell line (KG-1) |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 2671 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | NO |
Length of 3'UTR 1485 bp Genome contig ID gi89161207f_100035903 PolyA signal sequence
(ATTAAA,-19) +----*----+----*----+----*----+----
TAATGTGTAAAGGGAGATTAAAAAGTTTGAATGATFlanking genome sequence
(167075 - 167124) ----+----*----+----*----+----*----+----*----+----*
TATCCTACCATGTAGTCATTAACTTTGCTGCATTTCTTTGGGATTTCAGA
Chr f/r start end exon identity class ContigView(URL based/DAS) 4 f 100135903 100202976 11 100.0 Perfect prediction
Features of the protein sequence |
Description | |
---|---|---|
Length: 394 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
No significant homologues
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
FPrintScan | IPR001714 | 201 | 214 | PR00599 | Peptidase M24 |
IPR001714 | 223 | 239 | PR00599 | Peptidase M24 | |
IPR001714 | 293 | 305 | PR00599 | Peptidase M24 | |
IPR001714 | 324 | 336 | PR00599 | Peptidase M24 | |
HMMPfam | IPR000994 | 145 | 381 | PF00557 | Peptidase M24 |
HMMTigr | IPR002467 | 136 | 382 | TIGR00500 | Peptidase M24A |
ScanRegExp | IPR002467 | 299 | 317 | PS00680 | Peptidase M24A |
Method | No. | N terminal | transmembrane region | C terminal | type | length |
---|---|---|---|---|---|---|
- | - | - | - | - | - | - |
Expression profile |
Description | |
---|---|---|
RH mapping information |
Description | |
---|---|---|
: 4 |
: Genebridge 4 | |
: CCCCCTTTCTTCCCTTTTCTG | |
: GGACAACTGCTGAAAGGAACG | |
: 323 bp | |
: 95 °C |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage ![]() | |