HUGE

Gene/Protein Characteristic Table for KIAA0086

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00403
Accession No. :	D42045
Description :	DNA cross-link repair 1A protein.
HUGO Gene Name :	DNA cross-link repair 1A (PSO2 homolog, S. cerevisiae) (DCLRE1A)
Clone Name :	ha03611 [Vector Info]
Flexi ORF Clone :	pF1KSDA0086
Source :	Myeloblast cell line (KG-1)

Features of the cloned DNA sequence	Description

Length: 4468 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 427 bp

Genome contig ID gi89161187r_115484474
PolyA signal sequence
(AATAAA,-22)
+----*----+----*----+----*----+----
ACGTGTATACTTAAATAAAATTAATATAAAATTTG
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
CTCTGGTGTCTTTTGTTTTTTTTGTTTGTTTTTAATAGATTTTATTTTAT

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 10 r 115584474 115603849 9 100.0 Perfect prediction

Features of the protein sequence	Description

Length: 1044 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
AAH13124	100.0	DNA cross-link ...	Homo sapiens
Q6PJP8	99.9	DNA cross-link ...	Homo sapiens
AAH62582	99.8	DNA cross-link ...	Homo sapiens
XP_508045	98.8	DNA-crosslink r...	Pan troglodytes
XP_001090942	93.7	DNA-crosslink r...	Macaca mulatta

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR011084 923 1021 PF07522 DNA repair metallo-beta-lactamase

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR011084	923	1021	PF07522	DNA repair metallo-beta-lactamase

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: Northern blot Description

Northern blot	Description

RH mapping information	Description

Chromosome No.

: 10

Experimental conditions

Panel name	: Genebridge 4
Primer_f	: ACAGGATGGACACACTCTAAC
Primer_r	: GGTGCCCACATTTACAGTAGG
PCR product length	: 177 (1.6k) bp
PCR conditions	: 95 °C15 sec62 °C120 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	427 bp
Genome contig ID	gi89161187r_115484474
PolyA signal sequence (AATAAA,-22)	+--------+--------+----*----+---- ACGTGTATACTTAAATAAAATTAATATAAAATTTG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* CTCTGGTGTCTTTTGTTTTTTTTGTTTGTTTTTAATAGATTTTATTTTAT

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	10	r	115584474	115603849	9	100.0	Perfect prediction

Gene/Protein Characteristic Table for KIAA0086

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information