HUGE

Gene/Protein Characteristic Table for KIAA0076

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00397
Accession No. :	D38548
Description :	Cullin-7.
HUGO Gene Name :
Clone Name :	ha00936 [Vector Info]
Flexi ORF Clone :	pF1KSDA0076
Source :	Myeloblast cell line (KG-1)

Features of the cloned DNA sequence	Description

Length: 5253 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 70 bp

Genome contig ID gi89161210r_43013334
PolyA signal sequence
(ATTAAA,-23)
+----*----+----*----+----*----+----
GCTTTTACAGAAATTAAACCCAAGAGTTTGATTAT
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
ATGACGTGTGTGTTTGGCGACTGCTAGAGATTTGAGTGGGGAGGTGGGAG

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 6 r 43113334 43129415 26 99.7 Perfect prediction

Features of the protein sequence	Description

Length: 1701 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
AAH33647	100.0	Cullin 7 [Homo ...	Homo sapiens
Q14999	99.9	Cullin-7; Short...	Homo sapiens
BAF85495	99.9	unnamed protein...	Homo sapiens
XP_001136655	99.6	cullin 7 [Pan t...	Pan troglodytes
XP_001088003	97.2	cullin 7 [Macac...	Macaca mulatta

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB014608	5.1e-181	62.2	KIAA0708
AB007859	4.7e-12	42.4	KIAA0399

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR004939 815 997 PF03256 Anaphase-promoting complex subunit 10

IPR001373 1046 1548 PF00888 Cullin

ProfileScan IPR001373 1218 1509 PS50069 Cullin

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR004939	815	997	PF03256	Anaphase-promoting complex subunit 10
IPR001373	1046	1548	PF00888	Cullin
ProfileScan	IPR001373	1218	1509	PS50069	Cullin

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: Northern blot Description

Northern blot	Description

RH mapping information	Description

Chromosome No.

: 6

Experimental conditions

Panel name	: Genebridge 4
Primer_f	: TTTGGTCAGCAGCCTTGGTAA
Primer_r	: ATCTGTAGGGTATGGAAGGTG
PCR product length	: 219 bp
PCR conditions	: 95 °C15 sec65 °C120 sec32 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	70 bp
Genome contig ID	gi89161210r_43013334
PolyA signal sequence (ATTAAA,-23)	+--------+--------+----*----+---- GCTTTTACAGAAATTAAACCCAAGAGTTTGATTAT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* ATGACGTGTGTGTTTGGCGACTGCTAGAGATTTGAGTGGGGAGGTGGGAG

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	6	r	43113334	43129415	26	99.7	Perfect prediction

Gene/Protein Characteristic Table for KIAA0076

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information