HUGE

Gene/Protein Characteristic Table for KIAA0066

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK01052
Accession No. :	D31886
Description :	Rab3 GTPase-activating protein catalytic subunit.
HUGO Gene Name :	RAB3 GTPase activating protein subunit 1 (catalytic) (RAB3GAP1)
Clone Name :	ha01217 [Vector Info]
Flexi ORF Clone :	pF1KA0066
Source :	Myeloblast cell line (KG-1)

Features of the cloned DNA sequence	Description

Length: 3635 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 687 bp

Genome contig ID gi89161199f_135426468
PolyA signal sequence
(None)
+----*----+----*----+----*----+----
ATGTCACTGCAAATTAGTTTTATATCTGTCATGTG
Flanking genome sequence
(217042 - 217091)
----+----*----+----*----+----*----+----*----+----*
AGATTTGTCTTACTTATTTTTCTTTTGGTTGCCATGGAAGTTATGGCCCT

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 2 f 135526346 135643508 24 100.0 Perfect prediction

Features of the protein sequence	Description

Length: 981 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
XP_525929	99.7	RAB3 GTPase-act...	Pan troglodytes
XP_001153005	99.0	RAB3 GTPase-act...	Pan troglodytes
XP_001152623	99.7	RAB3 GTPase-act...	Pan troglodytes
XP_001096972	97.8	similar to RAB3...	Macaca mulatta
XP_001489520	95.9	similar to RAB3...	Equus caballus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output)
No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

Motif_DB interpro_ID From To Entry Definition

None - - - - -

Motif_DB	interpro_ID	From	To	Entry	Definition
None	-	-	-	-	-

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: Northern blot Description

Northern blot	Description

RH mapping information	Description

Chromosome No.

: 2

Experimental conditions

Panel name	: Genebridge 4
Primer_f	: TGAGGGGAAAAAGACAAGTGC
Primer_r	: CCTACCTCTCCCTTTTCCTTA
PCR product length	: 123 bp
PCR conditions	: 95 °C15 sec64 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	687 bp
Genome contig ID	gi89161199f_135426468
PolyA signal sequence (None)	+--------+--------+----*----+---- ATGTCACTGCAAATTAGTTTTATATCTGTCATGTG
Flanking genome sequence (217042 - 217091)	----+--------+--------+--------+--------+----* AGATTTGTCTTACTTATTTTTCTTTTGGTTGCCATGGAAGTTATGGCCCT

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	2	f	135526346	135643508	24	100.0	Perfect prediction

Gene/Protein Characteristic Table for KIAA0066

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information