HUGE

Gene/Protein Characteristic Table for KIAA0058

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK01657
Accession No. :	D31767
Description :	DAZ-associated protein 2.
HUGO Gene Name :	DAZ associated protein 2 (DAZAP2)
Clone Name :	ha01532 [Vector Info]
Flexi ORF Clone :	pF1KA0058
Source :	Myeloblast cell line (KG-1)

Features of the cloned DNA sequence	Description

Length: 1897 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 1321 bp

Genome contig ID gi89161190f_49818890
PolyA signal sequence
(AATAAA,-19)
+----*----+----*----+----*----+----
CTATTTTGAAGATTTGAATAAAGTGATGAAGTTGC
Flanking genome sequence
(104942 - 104991)
----+----*----+----*----+----*----+----*----+----*
ATTACACCTCACTGCAAGGATTCTTTACTTAGCTTGTTTTTAGATTTCTT

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 12 f 49918890 49923830 4 100.0 Perfect prediction

Features of the protein sequence	Description

Length: 181 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
CAI29743	7.7e-52	99.4	hypothetical pr...	Pongo abelii
Q9DCP9	7.7e-52	99.4	DAZ-associated ...	Mus musculus
ACJ06404	7.7e-52	99.4	DAZ-associated ...	Sus scrofa
Q4R5H7	1.1e-51	99.4	DAZ-associated ...	Macaca fascicularis
AAR11454	1.1e-51	99.4	DAZAP2 [Homo sa...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

BlastProDom NULL 80 181 PD093875 NULL

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	NULL	80	181	PD093875	NULL

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: Northern blot Description

Northern blot	Description

RH mapping information	Description

Chromosome No.

: 12

Experimental conditions

Panel name	: Genebridge 4
Primer_f	: CACTTCTCCCCACTCGTCATC
Primer_r	: TTGGGTTAGGTTCGTGTATGC
PCR product length	: 176 bp
PCR conditions	: 95 °C15 sec64 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	1321 bp
Genome contig ID	gi89161190f_49818890
PolyA signal sequence (AATAAA,-19)	+--------+--------+----*----+---- CTATTTTGAAGATTTGAATAAAGTGATGAAGTTGC
Flanking genome sequence (104942 - 104991)	----+--------+--------+--------+--------+----* ATTACACCTCACTGCAAGGATTCTTTACTTAGCTTGTTTTTAGATTTCTT

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	12	f	49918890	49923830	4	100.0	Perfect prediction

Gene/Protein Characteristic Table for KIAA0058

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information