HUGE |
Gene/Protein Characteristic Table for KIAA0044 |
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Expression | Mapping | |
Product ID : | ORK01954 |
---|---|
Accession No. : | D26445 |
Description : | Serine/threonine-protein phosphatase 2A 56 kDa regulatory subunit gamma isoform. |
HUGO Gene Name : | |
Clone Name : | ha00492 [Vector Info] |
Flexi ORF Clone : | pF1KA0044
![]() |
Source : | Myeloblast cell line (KG-1) |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 3702 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | NO |
Length of 3'UTR 2247 bp Genome contig ID gi51511730f_101246036 PolyA signal sequence
(AATAAA,-27) +----*----+----*----+----*----+----
ACATTGGAAATAAACCGGTGACTGTTTTTCTTCATFlanking genome sequence
(217575 - 217624) ----+----*----+----*----+----*----+----*----+----*
AAAGTTCTGCGTTTGGCATCTTCACTCTTTCCAAAATGTATCTGTACATC
Chr f/r start end exon identity class ContigView(URL based/DAS) 14 f 101346036 101463609 13 99.4 Perfect prediction
Features of the protein sequence |
Description | |
---|---|---|
Length: 484 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
No significant homologues
Expression profile |
Description | |
---|---|---|
RH mapping information |
Description | |
---|---|---|
: 14 |
: Stanford G3 | |
: ACCCCGTTCCGTAGGCAATAA | |
: GTGCTTTCCTATCGCTCTGAC | |
: 183 bp | |
: 95 °C |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage ![]() | |