HUGE

Gene/Protein Characteristic Table for KIAA0036

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00379
Accession No. :	D25278
Description :	IQ calmodulin-binding motif-containing protein 1.
HUGO Gene Name :	IQ motif containing B1 (IQCB1)
Clone Name :	ha02085 [Vector Info]
Flexi ORF Clone :	pF1KSDA0036
Source :	Myeloblast cell line (KG-1)

Features of the cloned DNA sequence	Description

Length: 2535 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 582 bp

Genome contig ID gi89161205r_122871300
PolyA signal sequence
(ATTAAA,-21)
+----*----+----*----+----*----+----
AATGCATTCTTTCTATTAAACTGTGAGAACTACAT
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AATGTACTGTTTCCCTTTTTGTCTTTTCTCCTAGGAATCTCAAAGCTAAA

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 3 r 122971300 123036563 15 99.4 Perfect prediction

Features of the protein sequence	Description

Length: 632 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
XP_001150926	0	98.6	nephrocystin 5 ...	Pan troglodytes
Q15051	0	100.0	IQ calmodulin-b...	Homo sapiens
AAW47233	0	99.8	nephrocystin 5 ...	Homo sapiens
XP_001502301	2.1e-203	89.8	IQ motif contai...	Equus caballus
XP_535758	1.6e-200	88.6	similar to IQ c...	Canis lupus fam...

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB032945	0.00051	23.8	KIAA1119

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR000048 329 349 PF00612 IQ calmodulin-binding region

IPR000048 422 442 PF00612 IQ calmodulin-binding region

HMMSmart IPR000048 327 349 SM00015 IQ calmodulin-binding region

IPR000048 420 442 SM00015 IQ calmodulin-binding region

ProfileScan IPR000048 328 357 PS50096 IQ calmodulin-binding region

IPR000048 421 450 PS50096 IQ calmodulin-binding region

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR000048	329	349	PF00612	IQ calmodulin-binding region
IPR000048	422	442	PF00612	IQ calmodulin-binding region
HMMSmart	IPR000048	327	349	SM00015	IQ calmodulin-binding region
IPR000048	420	442	SM00015	IQ calmodulin-binding region
ProfileScan	IPR000048	328	357	PS50096	IQ calmodulin-binding region
IPR000048	421	450	PS50096	IQ calmodulin-binding region

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: Northern blot Description

Northern blot	Description

RH mapping information	Description

Chromosome No.

: 6

Experimental conditions

Panel name	: Genebridge 4
Primer_f	: CCTAGCGAAGTGCCGTAAGA
Primer_r	: GCTCCCTACTGACCACATCT
PCR product length	: 155 bp
PCR conditions	: 95 °C15 sec62 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	582 bp
Genome contig ID	gi89161205r_122871300
PolyA signal sequence (ATTAAA,-21)	+--------+--------+----*----+---- AATGCATTCTTTCTATTAAACTGTGAGAACTACAT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AATGTACTGTTTCCCTTTTTGTCTTTTCTCCTAGGAATCTCAAAGCTAAA

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	3	r	122971300	123036563	15	99.4	Perfect prediction

Gene/Protein Characteristic Table for KIAA0036

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information