| HUGE |
Gene/Protein Characteristic Table for KIAA0033 |
|
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
| Features : DNA sequence | Protein sequence | Expression | Mapping | |
| Product ID : | ORK00377 |
|---|---|
| Accession No. : | D26067 |
| Description : | Transmembrane protein 41B. |
| HUGO Gene Name : | transmembrane protein 41B (TMEM41B) |
| Clone Name : | ha02009 [Vector Info] |
| Flexi ORF Clone : | pF1KSDA0033
![]() |
| Source : | Myeloblast cell line (KG-1) |
Features of the cloned DNA sequence |
Description | |
|---|---|---|
Length: 3269 bp
|
| cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | NO |
Length of 3'UTR 2260 bp Genome contig ID gi51511727r_9159292 PolyA signal sequence
(AATAAA,-30) +----*----+----*----+----*----+----
TTAAAAATAAAAGAGCTTAGACTCAGTAGGAACTCFlanking genome sequence
(99995 - 99946) ----+----*----+----*----+----*----+----*----+----*
AGTAGAAGCTTCACTATTTACTCCAGCGTGTGTAAATTGTACTTACTCTA
Chr f/r start end exon identity class ContigView(URL based/DAS) 11 r 9259287 9292697 7 99.3 Perfect prediction
Features of the protein sequence |
Description | |
|---|---|---|
Length: 335 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
No significant homologues
Expression profile |
Description | |
|---|---|---|
RH mapping information |
Description | |
|---|---|---|
| : 11 |
| : Stanford G3 | |
| : TAATCATCCTCAAAGCCTGTT | |
| : TAAATAATCCTCACGCAAAAG | |
| : 155 bp | |
| : 95 °C |
|
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage
| |