HUGE

Gene/Protein Characteristic Table for KIAA0017

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Mapping

Product ID :	ORK00365
Accession No. :	D87686
Description :	Splicing factor 3B subunit 3.
HUGO Gene Name :	splicing factor 3b, subunit 3, 130kDa (SF3B3)
Clone Name :	ha02425 [Vector Info]
Flexi ORF Clone :	pF1KSDA0017
Source :	Myeloblast cell line (KG-1)

Features of the cloned DNA sequence	Description

Length: 4294 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 484 bp

Genome contig ID gi51511732f_69015247
PolyA signal sequence
(AATAGA,-24)
+----*----+----*----+----*----+----
ATCTAACCAGAAATAGAAACCTAGTTTTTAAGGTG
Flanking genome sequence
(148456 - 148505)
----+----*----+----*----+----*----+----*----+----*
ACTGGCATCCATGTGTCTTGTTCTGGAGATGAGGATGTAGGTGGGAGGTT

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 16 f 69115247 69163701 26 99.9 Perfect prediction

Features of the protein sequence	Description

Length: 1253 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q15393	100.0	Splicing factor...	Homo sapiens
XP_536791	99.9	similar to spli...	Canis lupus fam...
BAF84457	99.9	unnamed protein...	Homo sapiens
Q921M3	99.9	Splicing factor...	Mus musculus
AAH68974	99.9	Splicing factor...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR004871 896 1195 PF03178 CPSF A subunit

ScanRegExp IPR003006 323 329 PS00290 Immunoglobulin/major histocompatibility complex motif

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR004871	896	1195	PF03178	CPSF A subunit
ScanRegExp	IPR003006	323	329	PS00290	Immunoglobulin/major histocompatibility complex motif

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

RH mapping information	Description

Chromosome No.

: 16

Experimental conditions

Panel name	: Stanford G3
Primer_f	: GGAATCAGGAGTTGTCACCA
Primer_r	: AAACCACAGGAGTCAATCAG
PCR product length	: 124 bp
PCR conditions	: 95 °C15 sec62 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	484 bp
Genome contig ID	gi51511732f_69015247
PolyA signal sequence (AATAGA,-24)	+--------+--------+----*----+---- ATCTAACCAGAAATAGAAACCTAGTTTTTAAGGTG
Flanking genome sequence (148456 - 148505)	----+--------+--------+--------+--------+----* ACTGGCATCCATGTGTCTTGTTCTGGAGATGAGGATGTAGGTGGGAGGTT

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	16	f	69115247	69163701	26	99.9	Perfect prediction

Gene/Protein Characteristic Table for KIAA0017

Features of the cloned DNA sequence

Features of the protein sequence

RH mapping information