HUGE |
Gene/Protein Characteristic Table for KIAA0017 |
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Mapping | |
Product ID : | ORK00365 |
---|---|
Accession No. : | D87686 |
Description : | Splicing factor 3B subunit 3. |
HUGO Gene Name : | splicing factor 3b, subunit 3, 130kDa (SF3B3) |
Clone Name : | ha02425 [Vector Info] |
Flexi ORF Clone : | pF1KSDA0017
![]() |
Source : | Myeloblast cell line (KG-1) |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 4294 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | NO |
Length of 3'UTR 484 bp Genome contig ID gi51511732f_69015247 PolyA signal sequence
(AATAGA,-24) +----*----+----*----+----*----+----
ATCTAACCAGAAATAGAAACCTAGTTTTTAAGGTGFlanking genome sequence
(148456 - 148505) ----+----*----+----*----+----*----+----*----+----*
ACTGGCATCCATGTGTCTTGTTCTGGAGATGAGGATGTAGGTGGGAGGTT
Chr f/r start end exon identity class ContigView(URL based/DAS) 16 f 69115247 69163701 26 99.9 Perfect prediction
Features of the protein sequence |
Description | |
---|---|---|
Length: 1253 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
No significant homologues
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
HMMPfam | IPR004871 | 896 | 1195 | PF03178 | CPSF A subunit |
ScanRegExp | IPR003006 | 323 | 329 | PS00290 | Immunoglobulin/major histocompatibility complex motif |
Method | No. | N terminal | transmembrane region | C terminal | type | length |
---|---|---|---|---|---|---|
- | - | - | - | - | - | - |
RH mapping information |
Description | |
---|---|---|
: 16 |
: Stanford G3 | |
: GGAATCAGGAGTTGTCACCA | |
: AAACCACAGGAGTCAATCAG | |
: 124 bp | |
: 95 °C |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage ![]() | |