HUGE

Gene/Protein Characteristic Table for KIAA0008

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK04790
Accession No. :	D13633
Description :	Disks large-associated protein DLG7.
HUGO Gene Name :	discs, large (Drosophila) homolog-associated protein 5 (DLGAP5)
Clone Name :	ha00171s2 [Vector Info]
Flexi ORF Clone :	pF1KA0008
Source :	Myeloblast cell line (KG-1)
Note :	We replaced ha00171 and ha00171s1, former representative clones for KIAA0008 with ha00171s2. (2002/12/27,2008/8/27)

Features of the cloned DNA sequence	Description

Length: 2852 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 221 bp

Genome contig ID gi51511730r_54584601
PolyA signal sequence
(AATAAA,-23)
+----*----+----*----+----*----+----
TTTTCAACACAGAATAAAAAATGTACTGTGCCTTG
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
CCTCTCTTGTTTAAAAGGAATAAGCTTAAGGCTAAGTATACTTATTAGCA

Features of the protein sequence	Description

Length: 876 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q15398	100.0	Disks large-ass...	Homo sapiens
BAB97376	99.9	hepatoma up-reg...	Homo sapiens
BAF84536	99.9	unnamed protein...	Homo sapiens
CAD62583	99.6	unnamed protein...	Homo sapiens
XP_509961	98.2	hypothetical pr...	Pan troglodytes

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB023181	3.7e-07	25.1	KIAA0964

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR005026 340 637 PF03359 Guanylate-kinase-associated protein

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR005026	340	637	PF03359	Guanylate-kinase-associated protein

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: Northern blot Description

Northern blot	Description

RH mapping information	Description

Chromosome No.

: 14

Experimental conditions

Panel name	: Genebridge 4
Primer_f	: TACGGATTACAAGGTCAAAGG
Primer_r	: GAACCTGCTTTGCTGCTTGAG
PCR product length	: 201 (1.4k) bp
PCR conditions	: 95 °C15 sec62 °C120 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	221 bp
Genome contig ID	gi51511730r_54584601
PolyA signal sequence (AATAAA,-23)	+--------+--------+----*----+---- TTTTCAACACAGAATAAAAAATGTACTGTGCCTTG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* CCTCTCTTGTTTAAAAGGAATAAGCTTAAGGCTAAGTATACTTATTAGCA

Gene/Protein Characteristic Table for KIAA0008

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information