Order Kazusa clone(s) from : ![]() |
Product ID | ORK01109 |
---|---|
Accession No | AB014551 |
Description | Rho/Rac guanine nucleotide exchange factor (GEF) 2 |
Clone name | sj09778 |
Vector information | |
cDNA sequence | DNA sequence (4434 bp) Predicted protein sequence (1114 aa) |
HaloTag ORF Clone |
FHC01109
![]() |
Flexi ORF Clone | FXC01109 |
Source | |
Rouge ID |
mKIAA0651
by Kazusa Mouse cDNA Project
|
Note | We replaced hk01046, former representative clones for KIAA0651 with sj09778. (1999/12/25) |
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | Warning | No warning |
Length of 3'UTR | 1087 bp |
---|---|
Genome contig ID | gi89161185r_154083270 |
PolyA signal sequence (ATTAAA,-19) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (100000 - 99951) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 1 | r | 154183270 | 154226488 | 26 | 99.9 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
HMMPfam | IPR002219 | 169 | 219 | PF00130 | Protein kinase C |
IPR000219 | 367 | 559 | PF00621 | DH | |
IPR001849 | 601 | 699 | PF00169 | Pleckstrin-like | |
HMMSmart | IPR002219 | 169 | 215 | SM00109 | Protein kinase C |
IPR000219 | 367 | 559 | SM00325 | DH | |
IPR001849 | 601 | 701 | SM00233 | Pleckstrin-like | |
ProfileScan | IPR002219 | 168 | 215 | PS50081 | Protein kinase C |
IPR000219 | 363 | 560 | PS50010 | DH | |
IPR001849 | 600 | 699 | PS50003 | Pleckstrin-like | |
ScanRegExp | IPR002219 | 169 | 215 | PS00479 | Protein kinase C |
![]() |
---|
Primer_f | GCCTCCTATCTCCACATCTCT |
---|---|
Primer_r | GGGAAGAGGTCAGTATAGGTC |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | GeneBridge 4 |
---|---|
Primer_f | GCCTCCTATCTCCACATCTCT |
Primer_r | GGGAAGAGGTCAGTATAGGTC |
PCR product length | 100 bp |
PCR conditions | 95 °C![]() ![]() ![]() ![]() |