Order Kazusa clone(s) from : ![]() |
Product ID | ORK02013 |
---|---|
Accession No | AB023234 |
Description | Hermansky-Pudlak syndrome 5, transcript variant 2 |
Clone name | hk07512s1 |
Vector information | |
cDNA sequence | DNA sequence (4147 bp) Predicted protein sequence (1095 aa) |
Flexi ORF Clone | FXC02013 |
Source | Human adult brain |
Rouge ID |
mKIAA1017
by Kazusa Mouse cDNA Project
|
Note | We replaced hk07512, former representative clones for KIAA1017 with hk07512s1. (2002/5/10) |
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | No warning |
Length of 3'UTR | 823 bp |
---|---|
Genome contig ID | gi51511727r_18157458 |
PolyA signal sequence (AATAAA,-30) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (99724 - 99675) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 11 | r | 18257182 | 18300297 | 22 | 99.7 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
Primer_f | ACTCTTTATCCATGACCTCAG |
---|---|
Primer_r | TAATCCACTAGCAACAAGCAG |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | GeneBridge 4 |
---|---|
Primer_f | ACTCTTTATCCATGACCTCAG |
Primer_r | TAATCCACTAGCAACAAGCAG |
PCR product length | 165 bp |
PCR conditions | 95 °C![]() ![]() ![]() ![]() |