ROUGE |
Gene/Protein Characteristic Table for mKIAA1017 |
Link to : HUGE | SWISS-PROT/TrEMBL | |
Features : DNA sequence | Protein sequence | |
Accession No. : | AK129265 |
---|---|
Hermansky-Pudlak syndrome 5 protein homolog. | |
mpm03366 [Vector Info] | |
Source : | Mouse embryonic tail |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 4726 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | YES |
Length of 3'UTR 920 bp Genome contig ID gi65511124r_40745819 PolyA signal sequence
(AATAAA,-27) +----*----+----*----+----*----+----
ATGTTGGTAATAAATGATGAAGGTTTTCTTTAAGGFlanking genome sequence
(100000 - 99951) ----+----*----+----*----+----*----+----*----+----*
AGAACATGGATATGAGATTTACTTTGGAGCAATCAGAAGGAAGATTTTAG
KIAA Alignment based on: KIAA1017 DNA sequence, AA sequence, Physical map
Features of the protein sequence |
Description | |
Coding region: 430..1014, 1073..2164, 2193..3806
Length: 1096 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
How to obtain mKIAA clone(s) How to obtain anti mKIAA antibodies Back to the ROUGE Protein Database homepage ![]() | |