KIAA0765

Product ID	ORK00126
Accession No	AB018308
Description	RNA binding motif protein 12, transcript variant 1
Clone name	hk04803s1
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (5332 bp) Predicted protein sequence (952 aa)
HaloTag ORF Clone	FHC00126
Flexi ORF Clone	FXC00126
Source	Human adult brain
Rouge ID	mKIAA0765 by Kazusa Mouse cDNA Project
Note	We replaced hk04803, former representative clones for KIAA0765 with hk04803s1. (2002/5/10)

Length: 5332 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	2382 bp
Genome contig ID	gi51511747r_33601478
PolyA signal sequence (ATTAAA,-27)	+--------+--------+----*----+---- GGACTGTAATTAAATGCTTTGCCCTCTGGAACTTG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* ATTTTTGTGTATCTGAGATTTATTAACAGTGCTAACTGCTAAGGATACTG

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	20	r	33701478	33716224	2	100.0	Perfect prediction

Length: 952 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
CAH10603	99.9	hypothetical pr...	Homo sapiens
Q9NTZ6	100.0	RNA-binding pro...	Homo sapiens
CAC20441	99.9	RNA binding mot...	Homo sapiens
Q8SQ27	99.6	RNA-binding pro...	Macaca mulatta
ABY64675	99.5	RNA binding mot...	Papio anubis

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR000504	452	522	PF00076	RNA recognition motif
	IPR000504	566	636	PF00076	RNA recognition motif
	IPR000504	878	949	PF00076	RNA recognition motif
HMMSmart	IPR000504	325	395	SM00360	RNA recognition motif
	IPR000504	451	523	SM00360	RNA recognition motif
	IPR000504	565	637	SM00360	RNA recognition motif
	IPR000504	877	950	SM00360	RNA recognition motif
ProfileScan	IPR000504	324	399	PS50102	RNA recognition motif
	IPR000504	450	527	PS50102	RNA recognition motif
	IPR000504	876	952	PS50102	RNA recognition motif

Primer_f	TTAGAGGATTGACAGTACAGG
Primer_r	TTGAGGAGGCAGTATCTAGTG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	UniGene
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-