Order Kazusa clone(s) from : ![]() |
Product ID | ORK00126 |
---|---|
Accession No | AB018308 |
Description | RNA binding motif protein 12, transcript variant 1 |
Clone name | hk04803s1 |
Vector information | |
cDNA sequence | DNA sequence (5332 bp) Predicted protein sequence (952 aa) |
HaloTag ORF Clone |
FHC00126
![]() |
Flexi ORF Clone | FXC00126 |
Source | Human adult brain |
Rouge ID |
mKIAA0765
by Kazusa Mouse cDNA Project
|
Note | We replaced hk04803, former representative clones for KIAA0765 with hk04803s1. (2002/5/10) |
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | No warning |
Length of 3'UTR | 2382 bp |
---|---|
Genome contig ID | gi51511747r_33601478 |
PolyA signal sequence (ATTAAA,-27) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (100000 - 99951) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 20 | r | 33701478 | 33716224 | 2 | 100.0 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
HMMPfam | IPR000504 | 452 | 522 | PF00076 | RNA recognition motif |
IPR000504 | 566 | 636 | PF00076 | RNA recognition motif | |
IPR000504 | 878 | 949 | PF00076 | RNA recognition motif | |
HMMSmart | IPR000504 | 325 | 395 | SM00360 | RNA recognition motif |
IPR000504 | 451 | 523 | SM00360 | RNA recognition motif | |
IPR000504 | 565 | 637 | SM00360 | RNA recognition motif | |
IPR000504 | 877 | 950 | SM00360 | RNA recognition motif | |
ProfileScan | IPR000504 | 324 | 399 | PS50102 | RNA recognition motif |
IPR000504 | 450 | 527 | PS50102 | RNA recognition motif | |
IPR000504 | 876 | 952 | PS50102 | RNA recognition motif |
![]() |
Primer_f | TTAGAGGATTGACAGTACAGG |
---|---|
Primer_r | TTGAGGAGGCAGTATCTAGTG |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | UniGene |
---|---|
Primer_f | - |
Primer_r | - |
PCR product length | - |
PCR conditions | - |