KIAA1269

Product ID	ORK00791
Accession No	AB033095
Description	glucocorticoid modulatory element binding protein 2
Clone name	hk04070
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (4160 bp) Predicted protein sequence (531 aa)
HaloTag ORF Clone	FHC00791
Flexi ORF Clone	FXC00791
Source	Human adult brain
Rouge ID	mKIAA1269 by Kazusa Mouse cDNA Project

Length: 4160 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	2487 bp
Genome contig ID	gi51511747r_61589399
PolyA signal sequence (AATAAA,-22)	+--------+--------+----*----+---- TACTTTGATTTAAAATAAAAACAATTTTCATAGTT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* TGAGTGTCTATCTCTTGGAATGAAGTGTGGAGAGAAATCAAGTCTATAAA

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	20	r	61689399	61728775	10	99.2	Perfect prediction

Length: 531 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
BAG10021	8.1e-186	100.0	glucocorticoid ...	synthetic construct
Q9UKD1	5.7e-185	99.6	Glucocorticoid ...	Homo sapiens
XP_530318	1.5e-182	97.9	glucocorticoid ...	Pan troglodytes
EDL88735	5e-175	94.5	glucocorticoid ...	Rattus norvegicus
XP_001492891	2.1e-174	93.7	similar to Gluc...	Equus caballus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR000770	82	164	PF01342	SAND
HMMSmart	IPR000770	91	164	SM00258	SAND
ProfileScan	IPR000770	82	164	PS50864	SAND

Primer_f	GGGGAAGGTTGTTGTCAGCAC
Primer_r	TGTACGTGGTTGAGAAGGTCC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	GeneBridge 4
Primer_f	GGGGAAGGTTGTTGTCAGCAC
Primer_r	TGTACGTGGTTGAGAAGGTCC
PCR product length	139 bp
PCR conditions	95 °C15 sec66 °C60 sec30 cycles