KIAA0737

Product ID	ORK00121
Accession No	AB018280
Description	TOX high mobility group box family member 4, transcript variant 1
Clone name	hk03869
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (4174 bp) Predicted protein sequence (629 aa)
HaloTag ORF Clone	FHC00121
Flexi ORF Clone	FXC00121
Source	Human adult brain
Rouge ID	mKIAA0737 by Kazusa Mouse cDNA Project

Length: 4174 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	2276 bp
Genome contig ID	gi51511730f_20915493
PolyA signal sequence (CATAAA,-25)	+--------+--------+----*----+---- TGTAGAATCTCATAAAACAGTTTAAATACAAGCTT
Flanking genome sequence (121389 - 121438)	----+--------+--------+--------+--------+----* AAGTGGCTTATGAATCCTGTGAAGCTCATTTATGGACTAGTGTAAAACAA

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	14	f	21015246	21036880	9	99.8	Perfect prediction

Length: 629 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
O94842	9.1e-178	100.0	TOX high mobili...	Homo sapiens
CAH92707	1.5e-176	99.5	hypothetical pr...	Pongo abelii
CAH93190	2.3e-176	99.4	hypothetical pr...	Pongo abelii
XP_532626	1.9e-173	97.6	similar to Epid...	Canis lupus fam...
XP_001505212	8.9e-173	97.4	similar to epid...	Equus caballus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB018351	6.9e-19	36.3	KIAA0808

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR000135	246	264	PR00886	High mobility group box HMG1 and HMG2
	IPR000135	264	283	PR00886	High mobility group box HMG1 and HMG2
	IPR000135	283	303	PR00886	High mobility group box HMG1 and HMG2
HMMPfam	IPR000910	231	299	PF00505	HMG1/2 (high mobility group) box
HMMSmart	IPR000910	230	300	SM00398	HMG1/2 (high mobility group) box
ProfileScan	IPR000910	231	299	PS50118	HMG1/2 (high mobility group) box

Primer_f	CTTCACAGAGTTGCTACCAGG
Primer_r	ACATCTTTCACCCCTTAACAG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	GeneBridge 4
Primer_f	CTTCACAGAGTTGCTACCAGG
Primer_r	ACATCTTTCACCCCTTAACAG
PCR product length	90 bp
PCR conditions	95 °C15 sec62 °C60 sec30 cycles