Order Kazusa clone(s) from : ![]() |
Product ID | ORK07315 |
---|---|
Accession No | AB018272 |
Description | ubiquitin specific peptidase 34 |
Clone name | hk03615 |
Vector information | |
cDNA sequence | DNA sequence (4143 bp) Predicted protein sequence (1196 aa) |
Source | Human adult brain |
Note | Please refer to "Gene/Protein Characteristic Table for KIAA0570" because the cDNA sequence of KIAA0729 is included in KIAA0570. |
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | Warning | No warning |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
Primer_f | TATGATATGGTGTCCTCTGTG |
---|---|
Primer_r | ACCATTTATATACTGCCAGGC |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | UniGene |
---|---|
Primer_f | - |
Primer_r | - |
PCR product length | - |
PCR conditions | - |