Order Kazusa clone(s) from : ![]() |
Product ID | ORK05622 |
---|---|
Accession No | AB018348 |
Description | pecanex homolog (Drosophila) |
Clone name | hk02940s1 |
Vector information | |
cDNA sequence | DNA sequence (4204 bp) Predicted protein sequence (1327 aa) |
Source | Human adult brain |
Rouge ID |
mKIAA0805
by Kazusa Mouse cDNA Project
|
Note | We replaced hk02940, former representative clones for KIAA0805 with hk02940s1. (2002/5/10) |
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | Warning | No warning |
Length of 3'UTR | 218 bp |
---|---|
Genome contig ID | gi51511730f_70449501 |
PolyA signal sequence (AATAAA,-27) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (197124 - 197173) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 14 | f | 70549501 | 70646623 | 25 | 99.9 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Method | No. | N terminal | transmembrane region | C terminal | type | length | SOSUI2 | 1 | 34 | FWILPQLWIGINFDRLTLLALFD | 56 | SECONDARY | 23 | 2 | 63 | ENVLAVILAILVAFLGSILLIQG | 85 | PRIMARY | 23 | 3 | 125 | IAYSRPVYFCICCGLIWLLDYGS | 147 | SECONDARY | 23 | 4 | 172 | RDLVIVFTLCFPIVFFIGLLPQV | 194 | PRIMARY | 23 | 5 | 219 | LAALYSFICSIVAVALLYGLCYG | 241 | PRIMARY | 23 | 6 | 249 | GQHIPVLFSIFCGLLVAVSYHLS | 271 | PRIMARY | 23 | 7 | 322 | SDLVVCIVIGVLYFAIHVSTVFT | 344 | PRIMARY | 23 | 8 | 350 | LKYVLYTLVGFVGFVTHYVLPQV | 372 | PRIMARY | 23 | 9 | 411 | WLLFVEKNIIYPLIVLNELSSSA | 433 | SECONDARY | 23 | 10 | 495 | LFFMSILFNKLWELLYKLQFVYT | 517 | SECONDARY | 23 | 11 | 536 | PFAVPHSAMLFIQAAVSAFFSTP | 558 | SECONDARY | 23 | 12 | 560 | NPFLGSAIFITSYVRPVKFWER | 581 | SECONDARY | 22 |
---|
![]() |
Primer_f | GGGTACTAGAACTTGGGGCTG |
---|---|
Primer_r | GCTTTATTTGGGGATGGAGAC |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | GeneBridge 4 |
---|---|
Primer_f | GGGTACTAGAACTTGGGGCTG |
Primer_r | GCTTTATTTGGGGATGGAGAC |
PCR product length | 228 bp |
PCR conditions | 95 °C![]() ![]() ![]() ![]() |