Gene/Protein Characteristic Table for KIAA1871
Order Kazusa clone(s) from : Japan || Other countries
Product ID ORK07499
Accession No AB058774
Description zinc finger protein 594
Clone name hj05256s1
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
cDNA sequence DNA sequence (4862 bp)
Predicted protein sequence (821 aa)
Source Human adult brain
Note We replaced hj05256, former representative clones for KIAA1871 with hj05256s1. (2002/5/10)
Features of the cloned cDNA sequence
Description

Length: 4862 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis).

N-terminal truncation Coding interruption
cloned DNA seq No warning Warning
Integrity of 3' end
Length of 3'UTR 2297 bp
Genome contig ID gi51511734r_4923555
PolyA signal sequence
(AATAAA,-21)		 
+----*----+----*----+----*----+----
TAACTGAATGTTGAAATAAAAGTTATTTAAGAATT
Flanking genome sequence
(100000 - 99951)		 
----+----*----+----*----+----*----+----*----+----*
ACTTAGTGACTGTTTAGTATGTGCCAGGGGCCGTAATTAGATGGGGCTGA

Ensembl ContigView (Add our DAS server as a DAS source)


Chr f/r start end exon identity class
Ensembl gnome browser 17 r 5023555 5028416 1 99.0 Perfect prediction
Features of the protein sequence
Description

Length: 821 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
Q96JF6 0 100.0 Zinc finger pro...
 Homo sapiens
XP_523843 0 98.5 zinc finger pro...
 Pan troglodytes
EAW90352 0 97.9 hCG1775942, iso...
 Homo sapiens
XP_001918156 7.2e-209 61.0 similar to hCG1...
 Equus caballus
XP_001099720 7.2e-209 86.8 similar to zinc...
 Macaca mulatta
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against HUGE database (FASTA output, Multiple alignment)
Entry Exp ID% HUGE_ID
AB046831 4.9e-88 51.4 KIAA1611
AB075862 3.8e-85 50.9 KIAA1982
AB037770 3.3e-73 46.4 KIAA1349
AB075836 2.6e-69 43.2 KIAA1956
AB075827 3.6e-68 44.8 KIAA1947
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
BlastProDom IPR007087 141 164 PD000003 Zinc finger
IPR007087 169 192 PD000003 Zinc finger
IPR007087 197 220 PD000003 Zinc finger
IPR007087 225 248 PD000003 Zinc finger
IPR007087 253 276 PD000003 Zinc finger
IPR007087 281 304 PD000003 Zinc finger
IPR007087 310 332 PD000003 Zinc finger
IPR007087 418 441 PD000003 Zinc finger
IPR007087 447 469 PD000003 Zinc finger
IPR007087 474 497 PD000003 Zinc finger
IPR007087 502 525 PD000003 Zinc finger
IPR007087 530 552 PD000003 Zinc finger
IPR007087 610 633 PD000003 Zinc finger
IPR007087 638 661 PD000003 Zinc finger
IPR007087 666 689 PD000003 Zinc finger
IPR007087 694 717 PD000003 Zinc finger
IPR007087 722 744 PD000003 Zinc finger
HMMPfam IPR007087 141 163 PF00096 Zinc finger
IPR007087 169 191 PF00096 Zinc finger
IPR007087 197 219 PF00096 Zinc finger
IPR007087 225 247 PF00096 Zinc finger
IPR007087 253 275 PF00096 Zinc finger
IPR007087 281 303 PF00096 Zinc finger
IPR007087 309 331 PF00096 Zinc finger
IPR007087 337 359 PF00096 Zinc finger
IPR007087 390 412 PF00096 Zinc finger
IPR007087 418 440 PF00096 Zinc finger
IPR007087 446 468 PF00096 Zinc finger
IPR007087 474 496 PF00096 Zinc finger
IPR007087 502 524 PF00096 Zinc finger
IPR007087 530 552 PF00096 Zinc finger
IPR007087 582 604 PF00096 Zinc finger
IPR007087 610 632 PF00096 Zinc finger
IPR007087 638 660 PF00096 Zinc finger
IPR007087 666 688 PF00096 Zinc finger
IPR007087 694 716 PF00096 Zinc finger
IPR007087 722 744 PF00096 Zinc finger
IPR007087 775 797 PF00096 Zinc finger
HMMSmart IPR015880 113 135 SM00355 Zinc finger
IPR015880 141 163 SM00355 Zinc finger
IPR015880 169 191 SM00355 Zinc finger
IPR015880 197 219 SM00355 Zinc finger
IPR015880 225 247 SM00355 Zinc finger
IPR015880 253 275 SM00355 Zinc finger
IPR015880 281 303 SM00355 Zinc finger
IPR015880 309 331 SM00355 Zinc finger
IPR015880 337 359 SM00355 Zinc finger
IPR015880 390 412 SM00355 Zinc finger
IPR015880 418 440 SM00355 Zinc finger
IPR015880 446 468 SM00355 Zinc finger
IPR015880 474 496 SM00355 Zinc finger
IPR015880 502 524 SM00355 Zinc finger
IPR015880 530 552 SM00355 Zinc finger
IPR015880 582 604 SM00355 Zinc finger
IPR015880 610 632 SM00355 Zinc finger
IPR015880 638 660 SM00355 Zinc finger
IPR015880 666 688 SM00355 Zinc finger
IPR015880 694 716 SM00355 Zinc finger
IPR015880 722 744 SM00355 Zinc finger
IPR015880 775 797 SM00355 Zinc finger
ProfileScan IPR007087 141 168 PS50157 Zinc finger
IPR007087 169 196 PS50157 Zinc finger
IPR007087 197 224 PS50157 Zinc finger
IPR007087 225 252 PS50157 Zinc finger
IPR007087 253 280 PS50157 Zinc finger
IPR007087 281 308 PS50157 Zinc finger
IPR007087 309 336 PS50157 Zinc finger
IPR007087 337 364 PS50157 Zinc finger
IPR007087 362 389 PS50157 Zinc finger
IPR007087 390 417 PS50157 Zinc finger
IPR007087 418 445 PS50157 Zinc finger
IPR007087 446 473 PS50157 Zinc finger
IPR007087 474 501 PS50157 Zinc finger
IPR007087 502 529 PS50157 Zinc finger
IPR007087 530 557 PS50157 Zinc finger
IPR007087 582 609 PS50157 Zinc finger
IPR007087 610 637 PS50157 Zinc finger
IPR007087 638 665 PS50157 Zinc finger
IPR007087 666 693 PS50157 Zinc finger
IPR007087 694 721 PS50157 Zinc finger
IPR007087 722 749 PS50157 Zinc finger
IPR007087 775 802 PS50157 Zinc finger
ScanRegExp IPR007087 143 163 PS00028 Zinc finger
IPR007087 199 219 PS00028 Zinc finger
IPR007087 227 247 PS00028 Zinc finger
IPR007087 255 275 PS00028 Zinc finger
IPR007087 283 303 PS00028 Zinc finger
IPR007087 311 331 PS00028 Zinc finger
IPR007087 339 359 PS00028 Zinc finger
IPR007087 392 412 PS00028 Zinc finger
IPR007087 420 440 PS00028 Zinc finger
IPR007087 446 468 PS00028 Zinc finger
IPR007087 476 496 PS00028 Zinc finger
IPR007087 504 524 PS00028 Zinc finger
IPR007087 532 552 PS00028 Zinc finger
IPR007087 584 604 PS00028 Zinc finger
IPR007087 612 632 PS00028 Zinc finger
IPR007087 640 660 PS00028 Zinc finger
IPR007087 668 688 PS00028 Zinc finger
IPR007087 696 716 PS00028 Zinc finger
IPR007087 724 744 PS00028 Zinc finger
IPR007087 777 797 PS00028 Zinc finger
Expression profile
Description

RT-PCR-ELISA
Experimental conditions
Primer_f TACTCCCCTATGTCCTGTGTC
Primer_r TTGGGCTGGAATTTTAGTACC
PCR conditions 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RH mapping information
Description

Chromosome No. 17
Experimental conditions
Panel name unigene
Primer_f -
Primer_r -
PCR product length -
PCR conditions -
Order Kazusa clone(s) from : Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp