KIAA1248

Product ID	ORK00205
Accession No	AB033074
Description	NDRG family member 2, transcript variant 2
Clone name	hh03309a
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (1932 bp) Predicted protein sequence (368 aa)
HaloTag ORF Clone	FHC00205
Flexi ORF Clone	FXC00205
Source	Human adult brain
Rouge ID	mKIAA1248 by Kazusa Mouse cDNA Project

Length: 1932 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	823 bp
Genome contig ID	gi51511730r_20454772
PolyA signal sequence (AATAAA,-21)	+--------+--------+----*----+---- ACTTCTGCTATAACAATAAACTGTAGAGGAATCTG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AGTACCGTTATTATTCTTTGTCTAGGTGTGCCTGCATCATGCTCCTCTTC

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	14	r	20554772	20563704	15	99.5	Perfect prediction

Length: 368 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
BAG56997	1.7e-149	99.7	unnamed protein...	Homo sapiens
AAD43131	1e-148	100.0	syld709613 prot...	Homo sapiens
CAH92721	1.8e-148	99.7	hypothetical pr...	Pongo abelii
CAH92501	4.6e-148	99.4	hypothetical pr...	Pongo abelii
AAH93038	5.3e-148	99.4	NDRG family mem...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB033006	5e-79	62.3	KIAA1180

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR004142	37	315	PF03096	Ndr

Primer_f	TCAGTGTGCATCTAGAGTGGG
Primer_r	TAGCAGAAGTTGTGGGAGACG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	unigene
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-